Skip to main content
NCBI home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2011 Sep 12;589(Pt 21):5091–5107. doi: 10.1113/jphysiol.2011.215772

Sexual dimorphism and oestrogen regulation of KCNE3 expression modulates the functional properties of KCNQ1 K+ channels

Rodrigo Alzamora 1, Fiona O'Mahony 1, Viviana Bustos 2,3, Raphael Rapetti-Mauss 1, Valérie Urbach 1, L Pablo Cid 2, Francisco V Sepúlveda 2, Brian J Harvey 1
PMCID: PMC3225667  PMID: 21911611

Non-technical summary

High levels of oestrogen are known to cause fluid retention in fertile females. It is thought that the increase in body fluid volume is necessary for proper implantation of the fertilised egg in the uterus. We show that the activity of a potassium ion channel, which drives salt and water movement across the cell membranes of the intestine, is inhibited by oestrogen and this effect is only found in females and is maximal during the peak phase of oestrogen in the oestrous cycle (when fertilization and implantation occur). These findings help us to understand the molecular mechanisms underlying the fluid retention effects of oestrogen in health and the potential adverse effects this response may have in exacerbating disease where fluid secretion is compromised such as in cystic fibrosis (the so-called CF ‘gender gap’).

Abstract

Abstract

The KCNQ1 potassium channel associates with various KCNE ancillary subunits that drastically affect channel gating and pharmacology. Co-assembly with KCNE3 produces a current with nearly instantaneous activation, some time-dependent activation at very positive potentials, a linear current–voltage relationship and a 10-fold higher sensitivity to chromanol 293B. KCNQ1:KCNE3 channels are expressed in colonic crypts and mediate basolateral K+ recycling required for Cl− secretion. We have previously reported the female-specific anti-secretory effects of oestrogen via KCNQ1:KCNE3 channel inhibition in colonic crypts. This study was designed to determine whether sex and oestrogen regulate the expression and function of KCNQ1 and KCNE3 in rat distal colon. Colonic crypts were isolated from Sprague–Dawley rats and used for whole-cell patch-clamp and to extract total RNA and protein. Sheets of epithelium were used for short-circuit current recordings. KCNE1 and KCNE3 mRNA and protein abundance were significantly higher in male than female crypts. No expression of KCNE2 was found and no difference was observed in KCNQ1 expression between male and female (at oestrus) colonic crypts. Male crypts showed a 2.2-fold higher level of association of KCNQ1 and KCNE3 compared to female cells. In female colonic crypts, KCNQ1 and KCNE3 protein expression fluctuated throughout the oestrous cycle and 17β-oestradiol (E2 10 nm) produced a rapid (<15 min) dissociation of KCNQ1 and KCNE3 in female crypts only. Whole-cell K+ currents showed a linear current–voltage relationship in male crypts, while K+ currents in colonic crypts isolated from females displayed voltage-dependent outward rectification. Currents in isolated male crypts and epithelial sheets were 10-fold more sensitive to specific KCNQ1 inhibitors, such as chromanol 293B and HMR-1556, than in female. The effect of E2 on K+ currents mediated by KCNQ1 with or without different β-subunits was assayed from current–voltage relations elicited in CHO cells transfected with KCNQ1 and KCNE3 or KCNE1 cDNA. E2 (100 nm) reduced the currents mediated by the KCNQ1:KCNE3 potassium channel and had no effect on currents via KCNQ1:KCNE1 or KCNQ1 alone. Currents mediated by the complex formed by KCNQ1 and the mutant KCNE3-S82A β-subunit (mutation of the site for PKCδ-promoted phosphorylation and modulation of the activity of KCNE3) showed rapid run-down and insensitivity to E2. Together, these data suggest that oestrogen regulates the expression of the KCNE1 and KCNE3 and with it the gating and pharmacological properties of the K+ conductance required for Cl− secretion. The decreased association of the KCNQ1:KCNE3 channel complex promoted by oestrogen exposure underlies the molecular mechanism for the sexual dimorphism and oestrous cycle dependence of the anti-secretory actions of oestrogen in the intestine.

Introduction

KCNQ proteins form a family of five voltage-gated K+ channels, which play an important role in controlling the K+ current in several tissues (Robbins, 2001; Jespersen et al. 2005). The proteins have six transmembrane domains and can form functional homomeric channels in vitro. While KCNQ2–5 can associate with each other to form channel hetero-complexes, KCNQ1 does not form heteromers with other KCNQ subunits (Robbins, 2001; Jespersen et al. 2005). However, KCNQ1 associates with β-subunits of the KCNE family (Jespersen et al. 2005). The KCNE type I transmembrane peptides are a family of tissue specific β-subunits that associate with and fine tune the electrical and pharmacological properties of several voltage-gated K+ channels (McCrossan & Abbott, 2004). In heterologous expression systems, KCNQ1 channels have affinity for all five KCNE peptides forming K+ conducting complexes with different voltage activation, gating kinetics, unitary conductance and pharmacology (Melman et al. 2002a; McCrossan & Abbott, 2004). Of these complexes, the electrical properties and physiological roles of the KCNQ1:KCNE1 and KCNQ1:KCNE3 complexes have been well established (Barhanin et al. 1996; Schroeder et al. 2000).

Homomeric KCNQ1 expression induces a voltage-dependent, slowly activating and slowly deactivating outward K+ current (Barhanin et al. 1996; Tristani-Firouzi & Sanguinetti, 1998). When KCNQ1 is expressed together with KCNE1 the activation kinetics are considerably slowed by 10-fold, the unitary conductance is approximately 4-fold greater than that of homomeric KCNQ1 and the voltage dependency shifts toward more positive potentials, giving a current resembling the slow delayed rectifier cardiac current IKs (Barhanin et al. 1996; Tristani-Firouzi & Sanguinetti, 1998; Yang & Sigworth, 1998; Schroeder et al. 2000). In contrast, association with KCNE3 accelerates gating kinetics, eliminates voltage dependence and causes a fraction of the channels to remain open at all voltages (Schroeder et al. 2000; Mazhari et al. 2002; McCrossan & Abbott, 2004). These differences suggest that KCNE1 and KCNE3 interact with critical components of the channel gating machinery (Melman et al. 2001, 2002b; McCrossan & Abbott, 2004).

In the colon, KCNQ1 forms heteromultimeric channels with KCNE3, and localize at the basolateral membrane (Schroeder et al. 2000; Dedek & Waldegger, 2001; Kunzelmann et al. 2001; Vallon et al. 2005; Preston et al. 2010). These heteromers are constitutively open at the negative membrane voltages of intestinal epithelial cells and can be further activated by the action of cAMP (Warth et al. 1996; Schroeder et al. 2000). KCNQ1:KCNE3 complexes have been shown to mediate cAMP-activated Cl− secretion in small and large intestine, by recycling K+ that is transported into the cell by basolateral Na+–K+–2Cl− cotransporter and Na+–K+–ATPase (Kunzelmann & Mall, 2002; Jespersen et al. 2005; Liao et al. 2005). Furthermore, these channels are responsible for hyperpolarization required to maintain Cl− secretion.

Activation or inhibition of K+ channels in epithelia, particularly those secreting Cl−, has potentially useful therapeutic applications in diseases as diverse as cystic fibrosis, where Cl− secretion is deficient and secretory diarrhoea, where it is in excess (Kunzelmann & Mall, 2002; Field, 2003). Previously it has been shown that KCNQ1 channels are sensitive to chromanol 293B; however, their sensitivity seems to vary from tissue to tissue. It is known that association with KCNE subunits modulates the sensitivity of KCNQ1 to both activators and inhibitors, such as mefenamic acid and chromanol 293B, respectively (Lerche et al. 2000; Unsöld et al. 2000). Association of KCNQ1 channels with KCNE3 produces a 10-fold increase in the sensitivity of channel currents to chromanol 293B. Thus, the selectivity of this inhibitor is dependent on the type and level of expression of KCNE subunits colocalized with KCNQ1.

In previous studies we have found sex differences in the anti-secretory response to 17β-oestradiol in colon, which involves basolateral K+ channel inhibition (McNamara et al. 2000; Condliffe et al. 2001; O'Mahony et al. 2007, 2009). Recently we have shown that oestrogen can exert a female sex-specific protective effect against Cl− hypersecretion produced by bacterial enterotoxins (Alzamora et al. 2011). In this report, we examine the effect of sex on the expression of KCNE3 subunits in rat colonic crypt cells and the effect of such differences on the electrical properties of the KCNQ1 conductance in isolated crypt cells and colonic epithelia. In addition we demonstrate that 17β-oestradiol is capable of inhibiting heterologously expressed KCNQ1:KCNE3 channels, an effect that requires the presence of the KCNE3 subunit and could necessitate its phosphorylation.

Methods

Animals

All experiments in animals were conducted in accordance with the Department of Environment legislation and approved by The Ethics Committee of the Royal College of Surgeons in Ireland. Sprague–Dawley rats (300–350 g) were kept on a 12 h light–12 h dark cycle and were given ad libitum access to food and water. Following halothane anaesthesia rats were killed by cervical dislocation. Cervical smears were obtained from female rats and the oestrous cycle stage was determined. All female rats were used at the oestrus stage unless stated otherwise. The distal colon was removed and faecal contents were rinsed off. Colonic crypts were isolated using the calcium chelation technique, as previously described (Doolan & Harvey, 1996) while sheets of colonic mucosa were obtained by blunt dissection.

Isolation of colonic crypts

Rat distal colon was removed, everted on a glass rod, and placed in crypt isolation buffer, pH 7.4 (96 mm NaCl, 1.5 mm KCl, 10 mm Hepes-Tris, 27 mm EDTA, 55 mm sorbitol, 44 mm sucrose, 1 mm dithiothreitol) at room temperature for 40 min. The crypts were detached after the incubation by vigorous shaking, followed by centrifugation at 1000 g for 10 min. The pellet of crypts obtained was resuspended in Krebs solution (140 mm NaCl, 5 mm KCl, 1 mm MgCl2, 2 mm CaCl2, 10 mm Hepes, 10 mm Tris-HCl, 10 mm glucose). The purity of isolated intact crypts was verified under wide-field microscopy and was typically 100% without crypt fracture or free floating isolated cells. Isolated crypts presented a test-tube appearance with less than 10% of the structure containing surface villous cells. Previous studies (including those from our group) have shown that carrying out mechanical isolation at room temperature maintains crypt viability and avoids disintegration (Doolan and Harvey 1996; Schultheiss et al. 2002). Isolated crypts could be maintained intact for up to 4 days if stored at 4–6°C in a Krebs solution in which chloride salts were replaced by equimolar acetate salts. Immunolocalization studies have shown that in colonic epithelia KCNQ1:KCNE3 channels are exclusively expressed at the basolateral membrane of colonic crypts with no expression in surface cells (Liao et al. 2005). Therefore, for our studies, the presence of a low percentage of surface cells in the colonic crypt preparations is of minimal influence for the KCNQ1:KCNE3 expression and co-immunoprecipitation studies.

RNA isolation and semi-quantitative RT-PCR

Total RNA was isolated from colonic crypts using Qiagen RNeasy kit (Crawley, West Sussex, UK) following the manufacturer's instructions. The mRNAs were reverse-transcribed into cDNAs by using the Improm-II Reverse Transcriptase System (Promega, Southampton, UK) following the manufacturer's protocol. Table 1 shows the primers used for semi-quantitative RT-PCR analysis of KCNQ1 and KCNE subunits expression; glyceraldehyde-3-phosphate dehydrogenase (GADPH) was used as an internal control. PCR reactions were performed in a final volume of 25 μl containing 1 μl of synthesized cDNA, 12.5 μl of GoTaq Green Master Mix (Promega), and 0.5 μm of each pair of primers. Cycle parameters were: 30 s denaturation step at 94°C, 30 s annealing step at 55°C, and 1 min extension at 72°C. Before examining each gene, a standard curve of cycle number within the linear range for PCR amplification was generated. It was determined by semi-quantitative RT-PCR analysis that 25 cycles were optimal for KCNQ1 and KCNE subunits. The RT-PCR amplification products were analysed by 1% agarose gel electrophoresis and stained with ethidium bromide.

Table 1.

Oligonucleotide sequence of primers used for RT-PCR

Protein Primer sequence 5′→ 3′ Product size (bp) GenBank accession no.
KCNQ1 (F) CACATCCAGGGCCGCGTCTA 453 AJ133685
(R) GACTACAGAGCCCAGGAGCC
KCNE1 (F) AGAGTTTTGCTCCACATCAGGG 471 M22412
(R) GACCCACTTATCACTTGTCTAT
KCNE2 (F) AAGGGGGAAACATGACCACT 399 AF071003
(R) GGACTCTCGTTCTTTATCAGG
KCNE3 (F) ACGCTGTGCTAAAGGCTCTG 244 AJ271742
(R) AGGGGTCACTACGTTTGTCCA
GADPH (F) GCCAAAAGGGTCATCATCTCCG 373 XO2231
(R) CATTGGGGGTAGGAACACGGA
Open in a new tab

(F), sense; (R), antisense.

Co-immunoprecipitation and Western blotting

Co-immunoprecipitation and Western blotting of KCNQ1 and KCNE β subunits were carried out following our previously published techniques (O'Mahony et al. 2009). After experimental treatment, isolated colonic crypts were lysed in immunoprecipitation (IP) lysis buffer: Tris-HCl 50 mm, NaCl 150 mm, NP-40 1%, glycerol 3%, EDTA 2 mm, EGTA 2 mm, proteases inhibitors (Roche). Samples were homogenized by sonication, centrifuged at 19,319 g for 20 min and the supernatant used to determinate the protein concentration. Samples were pre-cleared with Protein G Sepharose beads in order to reduce non-specific protein binding. Anti-KCNQ1 antibody was immobilized on Protein G Sepharose beads using sodium cyanoborohydride as a cross linking reagent and incubate with protein overnight. Beads were washed with IP lysis buffer and eluted with elution buffer pH 2.8 (Pierce). Samples were subjected to standard 10% SDS-PAGE and Western blotting. Immunoblots were developed using specific antibodies against rat KCNQ1 and KCNE subunits. Co-immunoprecipitation assays were carried out as previously described by Dilly et al. (2004). In order to control the Co-IP specificity, negative controls were carried out for each sample following the Co-IP protocol described above. The KCNQ1 antibodies coupled with protein G beads and without proteins were subjected to the Co-IP protocol to control antibody presence in the lysate (Ab alone). The KCNQ1 antibody was then omitted and the beads were incubated with the proteins to control for non-specific binding to the beads (proteins without antibody).

Patch-clamp

Freshly isolated colonic crypts were transferred into a 1 ml perfusion chamber mounted on an inverted microscope (TE 2000-S, Nikon Ltd, Ireland). Patch pipettes were pulled and fire-polished using a programmable horizontal puller (DMZ-Universal, Zeitz-Instruments GmbH, Germany) and had an electrical resistance of 2–5 MΩ when filled with K+ solutions. The patch–clamp apparatus consisted of a CV-203BU head stage connected to an Axopatch 200B series amplifier (Axon Instruments, Union City, CA, USA). Patch-clamp experiments were performed at 37°C in the standard whole-cell recording configuration, and recorded membrane currents were filtered at 1 kHz through an 8 pole, low-pass Bessel filter and digitized at 5 kHz. The voltage clamp protocol consisted of a series of voltage steps from −100 mV to +100 mV in 20 mV increments from an initial holding potential of −50 mV. Colonic crypts were perfused at a rate of 1 ml min−1 in a standard bath solution containing (in mm): NaCl 140, KCl 5.4, MgCl2 1, CaCl2 1.25, Hepes 10, glucose 12.2, pH 7.4. The patch pipette solution contained: potassium gluconate 95, KCl 30, Na2ATP 4.8, KH2 PO4 1.2, EGTA 1, Ca(gluconate)2 0.73, MgCl2 1, ATP 3, d-glucose 5, pH 7.2. The protocols for patch-clamp and data analysis were established with routines using pCLAMP 9.2 software (Axon Instruments).

KCNQ1: KCNEx channel complex transfection and current recording in CHO cells

Constructs

hKCNQ1, hKCNE3 and hKCNE1 were kindly provided by Dr Steve A. Goldstein (Institute for Translational Medicine University of Chicago, IL, USA). hKCNQ1 was subcloned into the pCR3.1 vector. The ancillary subunits hKCNE3 and hKCNE1 were subcloned into the pIRES-CD8 vector provided by Dr Florian Lesage (Institut de Pharmacologie Moléculaire et Cellulaire, Sophia Antipolis, Valbonne, France). Mutations in hKCNE3 were produced by Pfu-based mutagenesis (QuickChange Kit; Stratagene, La Jolla, CA, USA) by standard protocols and the amplified regions were confirmed by sequencing (Cid et al. 2000).

Electrophysiological assays

Chinese hamster ovary (CHO) cells (American Type Cell Culture; USA) were cultured in Ham's F12 medium and transiently transfected with cDNAs for hKCNQ1 and the corresponding ancillary subunit hKCNE1 or hKCNE3, CD8 (1 μg, 1 μg, 0.3 μg, respectively) by electroporation. Transfected cells were plated in culture dishes and cultured in an incubator with 5% CO2 until use (24–48 h). Dynabeads CD8 (Invitrogen Dynal ASA, Oslo, Norway) were used to visually identify transfected cells (Díaz & Sepúlveda, 1995).

Cells in culture dishes were placed on the stage of an inverted microscope (DM IL Type DFC290, Leica), and the culture medium was replaced by a standard bathing solution containing (in mm): 135 sodium gluconate, 4 KCl, 1 potassium gluconate, 2 CaCl2, 1 MgCl2, 33 sucrose, and 10 Hepes/Tris, pH 7.4. Experiments were performed in the voltage-clamp whole-cell mode of the patch-clamp technique. All measurements were made at room temperature (22 ± 2°C). Pipettes (borosilicate, Harvard Apparatus, UK) were pulled to give a resistance of 3–5 MΩ when filled with the pipette solution which contained (in mm): 6 KCl, 134 potassium gluconate, 1 MgCl2, 5 EGTA, 1 Na3ATP, and 10 Hepes, pH 7.2.

Potentials were corrected for liquid junction shifts. Electrophysiological data were acquired via an Axopatch 200B amplifier and a Digidata 1320A digitizer (Axon Instruments). Further data analysis was done using features of SigmaPlot v. 11 (Systat Software Inc., San José, CA, USA).

Protocols

Holding voltage was −80 mV unless otherwise stated. Currents were elicited by potentials ranging from −100 mV to +80 mV, in 20 mV increments, for hKCNQ1 alone, hKCNQ1-hKCNE3 and the corresponding mutant hKCNQ1-hKCNE3S82A. hKCNQ1-hKCNE1 channel currents were studied in the −80 mV to +100 mV range. Deactivating tail currents were recorded at −30 mV after a series of either 200 ms or 1 s activating pulses. In each figure we show representative current traces for each combination of subunits and constructs. For 17β-oestradiol inhibition studies, a protocol of pulses designed to obtain a current–voltage relation as described above was given immediately after gaining access to the cell. Then, an 8 min experiment was run using a repetitive protocol consisting of pulses to −40, 0, +40 and +100 mV from a −80 mV holding potential with a 10 s period, to obtain a time course during which 17β-oestradiol was added. After this a further current–voltage protocol was taken.

Transepithelial transport studies

Colonic epithelia were mounted in Ussing chambers (Physiologic Instruments, San Diego, CA, USA) on inserts exposing an area of 0.5 cm2. Transepithelial potential difference was clamped to zero using an EVC-4000 voltage-clamp apparatus (World Precision Instruments, Aston, UK). The transepithelial short-circuit current (ISC) was recorded using Ag–AgCl electrodes in 3 m KCl agar bridges as previously described (Condliffe et al. 2001). Apical and basolateral baths were filled with Krebs–bicarbonate buffer (in mm: 120 NaCl, 25 NaHCO3, 3.3 KH2PO4, 0.8 K2HPO4, 1.2 MgCl2, 1.2 CaCl2, 10 d-glucose), pH 7.4 maintained at 37°C and oxygenated with a 95% O2–5% CO2 mixture. All preparations were allowed to equilibrate for 30–45 min before the experiments were performed. The ISC was defined as positive for anion flow from the basolateral to apical chamber.

To investigate the activity of basolateral K+ channels in isolation, the apical membrane was permeabilized by addition of 10 μm of the K+ ionophore amphotericin B in the presence of a mucosal to serosal K+ gradient established by the following bath solutions: apical (in mm), 145 potassium gluconate, 3 KH2PO4, 0.8 K2HPO4, 1.2 Mg(gluconate)2, 4 Ca(gluconate)2, 10 d-glucose, and 10 Hepes; basolateral, 145 sodium gluconate, 3.3 NaH2PO4, 0.8 Na2HPO4, 1.2 Mg(gluconate)2, 4 Ca(gluconate)2, 10 d-glucose, and 10 Hepes, as previously described (McNamara et al. 2000). Ouabain (1 mm) was added to the basolateral bath to inhibit Na+–K+–ATPase activity. The resulting ISC is due to the movement of K+ through channels in the basolateral membrane (IK). For measurement of IK current–voltage relationships, currents were elicited by imposition of 2 s test potentials between −100 and +100 mV in 20 mV increments, from an initial holding potential of −40 mV. Amphotericin B was used instead of nystatin to prevent elevation of intracellular calcium induced by this ionophore as previously described (McNamara et al. 1999). In colonic epithelia, KCNQ1:KCNE3 channels are activated by increases in intracellular calcium; therefore we used amphotericin B to prevent a calcium-dependent activation of these channels after apical membrane permeabilization. The degree of apical permeabilization was assessed from the Nernstian dependence of IK on potassium concentration in the apical solution as described in our previous studies (McNamara et al. 2000).

Statistical analysis

Densitometric analysis was performed using Genetools software (Syngene, Cambridge, UK). Statistical analysis was performed using Student's t test for analysis between two groups, and ANOVA and Tukey's post hoc test for analysis of multiple groups. P values of 0.05 and less were considered to be significant. Number of samples (n) refers to number of animals. Data are expressed as means ± SEM.

Materials

All antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Protein-G sepharose beads and ECL-plus detection system were from Amersham Biosciences (Little Chalfont, UK). Chromanol 293B was from Tocris (Avonmouth, UK). (3R,4S)-(+)-N-[3- Hydroxy - 2,2 - dimethyl-6 - (4,4,4-trifluorobutoxy) chroman-4-yl]-N-methyl-ethanesulfonamide (HMR-1556) was kindly provided by Dr Uwe Gerlach (Aventis Pharma Deutschland, Frankfurt-am-Main, Germany). All other drugs were from Sigma-Aldrich (Dublin, Ireland). Drugs were dissolved in DMSO or water as stock solutions and diluted appropriately. The final DMSO concentration in all experiments was less than 0.1%.

Results

Sexual dimorphism in KCNQ1 and KCNE subunit expression in colonic crypts

To determine expression levels of KCNQ1 and KCNE subunits semi-quantitative RT-PCR analysis was carried out. Figure 1A compares KCNQ1 expression levels between male and female (oestrous) colonic crypt cells. No significant difference was found in transcript levels between male and females (male 1.08 ± 0.05 fold-higher, n = 5, P > 0.05). We then examined whether sex differences exist in basal expression levels of KCNE subunits. Expression levels for KCNE1 and KCNE3 were 4.8 ± 0.6- and 10.4 ± 1.9-fold higher, respectively, compared to transcript levels in female crypt cells (P < 0.01, n = 5) (Fig. 1B and D). No expression of KCNE2 was found in either male or female colonic crypts (Fig. 1C).

Figure 1. Sex differences in KCNQ1 and KCNE subunits transcript expression.

Figure 1

Open in a new tab

Semi-quantitative RT-PCR analysis of KCNQ1 and KCNE subunit expression in male and female rat colonic crypts. Reverse transcribed cDNA from male and female colonic crypt cells was amplified using specific primers for rat KCNQ1 (A), rat KCNE1 (B), KCNE2 (C) and KCNE3 (D). The PCR reaction produced bands at the expected length for KCNQ1 and KCNE3 subunits. GADPH was used as an internal control to estimate cDNA loading. Values in graphs represent means ± SEM. *P < 001, n = 5 animals.

To verify sex differences in expression of KCNQ1 and KCNE subunits, we examined protein levels in colonic crypts from male and female (oestrous) rats. In agreement with our RT-PCR experiments, no significant difference was found for basal protein expression of KCNQ1 (male 1.1 ± 0.03-fold, n = 4) (Fig. 2A). However, KCNE1 and KCNE3 protein levels were significantly higher in male colonic crypts (KCNE1 6.2 ± 0.5, KCNE3 14.9 ± 0.9, P < 0.01, n = 4) (Fig. 2B and D). No expression of KCNE2 protein was detected in either male or female colonic crypts (Fig. 2C).

Figure 2. Sex differences in KCNQ1 and KCNE subunits protein expression.

Figure 2

Open in a new tab

Western blot analysis of KCNQ1 and KCNE proteins in male and female rat colonic crypts. Total protein was transferred to PVDF membranes after fractioning by SDS-PAGE and blotted with antibody to rat KCNQ1 (A) and rat KCNE1 (B), KCNE2 (C) and KCNE3 (D). β-Actin was used as an internal control to estimated protein loading. Values in graphs represent means ± SEM. *P < 001, n = 4 animals.

In colonic crypts association of KCNQ1 with KCNE3 results in a channel complex responsible for K+ recycling at the basolateral membrane. Therefore, we compared the level of association of KCNQ1 with KCNE3 between male and female colonic crypts by immunoprecipitating KCNQ1 and measuring the amount of KCNE3 in the immunoprecipitate. Male cells showed a higher level of association between KCNQ1 and KCNE3 compared to female cells (2.25 ± 0.21-fold higher, P < 0.01, n = 3) (Fig. 3A).

Figure 3. Sexual dimorphism and oestrogen-dependent differences in KCNQ1 and KCNE3 association.

Figure 3

Open in a new tab

Western blotting analysis of Co-immunoprecipitation of KCNQ1 and KCNE3 proteins in male and female rat colonic crypts. A, association of KCNQ1 and KCNE3 proteins in male and female rat colonic crypts. KCNQ1 protein was immunoprecipitated from total cellular lysate using an antibody specific to KCNQ1, and then associated KCNE3 was analysed by Western blot. KCNQ1 was used as an internal control to estimate protein loading. A, sexual dimorphism of KCNQ1: KCNE3 protein:protein interaction. B and C, oestrogen modulated changes in KCNQ1:KCNE3 association in male (B) and female (C) colonic crypts. Colonic crypts were treated with 10 nm oestrogen for 15 min (15′ E2) or untreated (control). Values in graphs represent means ± SEM. **P < 0.01 n = 3 animals.

The effects of oestrogen on the association of KCNQ1:KCNE3 were examined by co-immunoprecipitation of the channel complex in isolated rat colonic crypts (Fig. 3B and C). E2 produced a rapid decrease in the association between KCNQ1 and KCNE3 (33.9 ± 8.7% of control, P < 0.01, n = 3) within 15 min exposure in colonic crypts isolated from female rats but had no effects in crypts from male rats (101.2 ± 1.5% of control). A control Co-IP with KCNE2 yielded no KCNE2 protein binding with KCNQ1 after oestrogen treatment in male or female colonic crypts (data not shown).

The oestrous cycle dependence of KCNQ1 and KCNE3 expression was also examined in female rat colonic crypts. KCNQ1 expression fluctuates throughout the oestrous cycle being maximal at oestrus and metaoestrus while it is at its lowest during prooestrus and dioestrus (Fig. 4A). Similarly, KCNE3 expression fluctuates throughout the oestrous cycle. However, KCNE3 expression pattern significantly differ from that of KCNQ1. KCNE3 expression was maximal at prooestrus and progressively decreasing reaching minimal levels at metaoestrus and dioestrus (Fig. 4B).

Figure 4. KCNQ1 and KCNE3 expression levels throughout the oestrous cycle.

Figure 4

Open in a new tab

A, KCNQ1 expression levels in female rat distal colonic crypts were measured by Western blot. The figure shows a representative blot of KCNQ1 proteins levels at different stages of the oestrous cycle. β-Actin expression was used as a protein loading control. The graph represents densitometric analysis of four individual experiments. B, KCNE3 expression levels in female rat distal colonic crypts were measured by Western blot. The figure shows a representative blot of KCNE3 proteins levels at different stages of the oestrous cycle. β-Actin expression was used as a protein loading control. The graph represents densitometric analysis of three individual experiments. Values are given as arbitrary units and expressed as means ± SEM. **P < 0.01, ***P < 0.001 determined by ANOVA and Tukey's post hoc test. Pro, prooestrus; Est, oestrus; Meta, metaoestrus; Dies, dioestrus.

Sexual dimorphism in whole-cell currents in colonic crypt cells

To study sex differences in KCNQ1 gating properties, whole-cell patch-clamp experiments were performed on epithelial cells derived from single isolated colonic crypts of rat colon. In both male and female colonic crypt cells whole-cell currents were activated by depolarizing clamp voltages. The whole-cell currents showed a reversal potential (Erev) of approximately −67 mV (Erev male = −68.2 ± 2.7, Erev female = −66.2 ± 3.0), which is close to the predicted Erev for a K+ conductance (−61.5 mV). These currents were sensitive to chromanol 293B, a specific KCNQ1 channel inhibitor with almost complete inhibition observed at 100 μm. The currents were activated by increasing temperature from 22°C to 37°C (data not shown). The KCNQ1 channel activity is temperature sensitive and increasing the temperature is known to activate the channel (Unsöld et al. 2000). Taken together, these results demonstrate the functional activity of KCNQ1 channels in rat distal colonic crypts.

In male colonic crypt cells whole-cell currents were instantaneous, with rapid deactivation and did not exhibit any delayed activated component (Fig. 5A). Whole cell currents for the male crypt appear to show slight inactivation. The most likely explanation for the transient inactivating currents in male crypts is the presence of KCNQ1:KCNE1 channel complexes. Male crypts were shown to express the KCNE1 subunit, which was absent from female crypts (see Fig. 2). KCNQ1:KCNE1 channel currents display this type of transient inactivation in heterlogous expression systems (Bendahhou et al. 2005). The current–voltage (I–V) relationship for these currents was linear with no outward rectification. There was no significant difference between whole-cell inward (γin) and outward conductance (γout) (γin = 702.7 ± 188.6 pS vs. γout = 613.5 ± 126.9 pS, P < 0.01, n = 7). Their linear I–V relationship led to significant currents at voltages more negative than −60 mV (Fig. 5B). Thus this conductance should be constitutively active at the negative membrane voltages of colonic epithelial cells. On the other hand, whole-cell currents measurements in female colonic crypt cells showed currents that activate slowly upon depolarization to voltages more positive than −60 mV and showed rapid deactivation (Fig. 5A). The I–V relationship for these currents showed voltage dependence and outward rectification (γin = 76.0 ± 15.6 pS vs. γout = 662.4 ± 97.3 pS, P < 0.01, n = 9) (Fig. 5B). At voltages below −60 mV whole-cell currents were near zero suggesting this conductance is largely inactive at the membrane voltages exhibit by colonic epithelial cells.

Figure 5. Sex differences in whole-cell currents in rat colonic crypts.

Figure 5

Open in a new tab

A, currents were activated by depolarizing voltage pulses applied in 20 mV increments from –100 mV to +100 mV in male and female rat distal colonic crypts. B, representative whole-cell current tracings of male and female colonic crypts. Current–voltage (I–V) relations obtained for voltage-activated whole-cell currents in from male (filled squares) and female (filled circles) rat distal colonic crypts. Values in graphs represent means ± SEM. *P < 001, n = 7 for male animals, n = 9 for female animals.

Sexual dimorphism in basolateral K+ currents in rat colonic epithelia

Basolateral K+ currents (IK) were generated in amphotericin B apically permeabilized rat colonic epithelia mounted in Ussing chambers. Treatment with chromanol 293B (100 μm) produced marked inhibition of basal and forskolin (10 μm) activated IK, suggesting the main component of this current is due to KCNQ1 channel activity (data not shown). In male tissues treatment with forskolin activated outward currents that displayed an almost linear IK–V relationship (inward IK 128.0 ± 10.5 μS, outward IK 143.8 ± 9.8 μS) with significant current at voltages below −40 mV (Fig. 6). In contrast, female epithelia showed forskolin-activated IK with strong outward rectification (inward IK 31.0 ± 4.2 μS, outward IK 109.8 ± 7.8 μS) and a voltage-dependent IK–V relationship. At voltages below −40 mV the current amplitude was significantly lower in female than in male colonic epithelia (Fig. 6).

Figure 6. Sex differences in basolateral K+ conductance in rat colonic epithelia.

Figure 6

Open in a new tab

Steady state short-circuit current/voltage relationship (IK–V) of basal (A) and forskolin-activated (B) basolateral K+ currents in male (filled circles) and female (open circles) rat colonic epithelia. Currents were measure in apically permeabilized epithelia in the presence of a basolaterally directed K+ gradient. Values represent means ± SEM, n = 5 animals.

Effect of sex on KCNQ1 sensitivity to chromanol 293B

Coexpression of KCNQ1 channels with KCNE3 results in a 10-fold increase in the sensitivity to chromanol 293B inhibition. In this study, we compared the effects of chromanol 293B on KCNQ1 currents between male and female rats in patch-clamp recordings of whole-cell currents in colonic crypt cells and in Ussing chamber measurements of basolateral K+ currents. Whole-cell currents from male colonic crypts were significantly more sensitive to chromanol 293B than currents from female colonic crypts. Figure 7A shows concentration–response curves for inhibition by chromanol 293B of whole-cell currents in colonic crypt cells from male and female rats. The IC50 for chromanol 293B in male cells was 1.45 ± 0.15 μm while IC50 in female crypt cell was 12.57 ± 1.74 μm; this represents a 10-fold higher sensitivity in male crypts compare to female (P < 0.05, n = 5).

Figure 7. Sex differences in chromanol 293B inhibitory response.

Figure 7

Open in a new tab

Concentration–responses curve for the inhibitory effect of chromanol 293B on whole-cell currents (IWC, A) and basolateral membrane K+ currents (IK, B) from male (filled circles) and female (open circles) rat distal colonic crypts. Currents (IWC or IK) were normalized to control currents (Icon) recorded in the absence of chromanol 293B. Values in graphs represent means ± SEM. *P < 001, n = 5 animals.

A similar sex difference in the sensitivity to chromanol 293B was observed in basolateral K+ currents between male and female colonic epithelia. Figure 7B shows concentration–response curves for inhibition of basolateral K+ currents by chromanol 293B in male and female colonic epithelia. IC50 for chromanol 293B in male colonic epithelia was 1.33 ± 0.17 μm while IC50 in female colonic epithelia was 14.40 ± 2.67 μm. Male tissues showed a 10-fold higher sensitivity to chromanol 293B compared to female epithelia (P < 0.05, n = 5).

Effect of sex on forskolin-induced ISC sensitivity to chromanol 293B

We also sought to examine the responses of intact colonic epithelia to chromanol 293B. In basal conditions, ISC was inhibited by chromanol 293B. Because basal currents in colonic epithelia are relatively low we stimulated short-circuit currents with forskolin (10 μm). The forskolin-activated ISC inhibition response curves for chromanol 293B were significantly different between male and female colonic epithelia (Fig. 8A). IC50 for chromanol 293B in male epithelia was 1.07 ± 0.10 μm while IC50 in female epithelia was 25.17 ± 5.09 μm; this represents a 10-fold higher sensitivity in male colonic epithelia compared to female tissues (P < 0.05, n = 5).

Figure 8. Sex differences in ISC inhibition by KCNQ1 inhibitors in rat colonic epithelia.

Figure 8

Open in a new tab

Concentration–responses curves for the inhibitory effect of chromanol 293B (A) and HMR-1556 (B) on forskolin-activated short-circuit currents (ISC) of male (filled circles) and female (open circles) rat colonic epithelia Currents (ISC) were normalized to control currents (Icon) recorded in the absence of chromanol 293B or HMR-1556 Values in graphs represent mean ± SEM. *P < 001, n = 5 animals.

In recent studies, several groups have reported that chromanol 293B is also an inhibitor of the cystic fibrosis transmembrane regulator (CFTR) channel and that the effect of chromanol 293B on ISC in intact colonic epithelia represents a mixture of its effect on both CFTR and KCNQ1 (Liao et al. 2005). Therefore, we repeated this experiment using the chromanol compound HMR-1556, a more potent and selective inhibitor of the KCNQ1 channel that has no effect on CFTR currents (Lerche et al. 2000). Like chromanol 293B, HMR-1556 also displays a 10-fold higher selectivity for KCNQ1 channels associated with KCNE3 subunits (Lerche et al. 2000). Figure 8B compares inhibition curves for HMR-1556 on forskolin-activated ISC showing a 10-fold higher sensitivity in male colonic epithelia compared to female tissues (IC50 male 54.7 ± 7.5 nm; female 457 ± 17.9 nm, P < 0.05, n = 5). However, unlike chromanol 293B, HMR-1556 only inhibited 60% of total ISC. Thus these experiments confirm the results obtained with chromanol 293B showing a sex difference in KCNQ1 channel inhibitor sensitivity at the whole tissue level.

Oestrogen inhibits currents elicited by KCNQ1:KCNE3 channel complex expressed in CHO cells

The data presented above show prevalence in female colon basolateral membranes of a form of the main cAMP-activated K+ conductance consistent of KCNQ1 homomers with little participation of ancillary β-subunits, be it KCNE1 or KCNE3. In addition, we will show here that acute addition of E2 to KCNQ1:KCNE3 channel complexes expressed in CHO cells leads to the type of voltage dependence prevalent in female colonic crypt cells. Our previous data suggest that rapid, non-genomic E2 inhibition of KCNQ1:KCNE3 is signalled by sex-specific protein kinase C-δ (PKCδ) activation (O'Mahony et al. 2007). Data presented above suggest that the E2 effect could involve a dissociation of KCNQ1 and KCNE3 with the consequent decrease in conductance at physiologically relevant voltages. To test this hypothesis we have co-expressed KCNQ1 and KCNE3 in CHO cells to study the effect of E2 on the resulting currents. CHO cells are a good expression platform for KCNQ1:KCNE3 assays (Melman et al. 2001) and show endogenous expression of PKCδ (see Supplementary Fig. 4). Figure 9A shows currents recorded in a cell expressing KCNQ1:KCNE3 with the expected near-instantaneous or fast activating currents consistent with channels open at the expected colonocyte membrane potential and a near-linear I–V curve (Fig. 9C). Immediately after measuring the currents shown in Fig. 9A, currents were sampled at 10 s intervals as shown in Fig. 9D. There was a rundown in KCNQ1:KCNE3 currents which are shown for pulses to −40 and 0 mV. Addition of 100 nm E2 at the time shown by the arrow led to fast current inhibition (see also first bars in Fig. 10). The decrease in KCNQ1:KCNE3 current was accompanied by a change in the kinetics as can be seen in Fig. 9E, where traces at the different voltages used are shown 20 s before and 10 and 40 s after E2 addition. These changes were not observed without E2 addition, when only the slow rundown of the current was present (Fig. 10 and Supplementary Fig. 1S). E2 inhibition was largest at the lower potentials and a significant slowing down of current activation occurred in the presence of the oestrogen at the most depolarized voltages (Fig. 9F). A family of currents taken at the end of the experiments shows this change in kinetics (Fig. 9B), as does the corresponding I–V curve (Fig. 9C), which shows marked outward rectification and inhibition at near physiological potentials.

Figure 9. Effect of 17β-oestradiol (E2) on currents mediated by the KCNQ1/KCNE3 potassium channel complex expressed in CHO cells.

Figure 9

Open in a new tab

(A) and (B): current families elicited in CHO cells transfected with KCNQ1 and KCNE3 cDNA before and after addition of 100 nM E2 respectively. Currents were elicited by square pulses taking the membrane from a holding potential of −80 mV to voltages between −100 and 80 mV in 20 mV steps. Post-pulse was to −30 mV. (C): end of pulse current-voltage relations for experiments as those shown in A and B. Means ± SEM of 6 experiments without or with 17b-estradiol. Currents in (A) were measured before and those in (B) after giving a train of 3-s pulse stimulations consisting of 500-ms square pulses to −40, 0, 40 and 100 mV. The holding potential was −80 mV and the period 10-s. (D): currents taken at the end of pulses to −40 and 0 mV of the train of pulses plotted for the duration of the experiment, with an arrow showing the time of 100 nM E2 addition. (E): currents elicited at the different voltages during the stimulus train taken 20 s before and 10 or 40 s after E2 addition. Time calibration bar 500 msecs. (F): times to reach 90% of maximal current as function of voltage for currents taken 20 s before and 40 s after E2 addition (means ± SEM, n = 5).

Figure 10. Effect of 17β-oestradiol on K+ currents mediated by KCNQ1 with or without different KCNE β-subunits.

Figure 10

Open in a new tab

The effect of E2 (100 nm) was assayed as described in Fig. 9. The percentage effect of E2 (or that due to channel rundown) was calculated comparing the current before E2 addition and that reached 120 s after E2. The data are means ± SEM, with n = 5 for KCNQ1:KCNE3(first bar in the graphs), n = 5 for KCNQ1:KCNE3 without addition of E2 (second bar), n = 4 for KCNQ1 without β-subunit, n = 5 for KCNQ1:KCNE1, and n = 5 for KCNQ1:KCNE3-S82A. Data are for measurements taken at –40 and 0 mV, except for the KCNQ1:KCNE1 constructs where figures correspond to measurements at 0 and 40 mV, respectively.

As seen above, and as reported before (Arrighi et al. 2001), KCNE1 β-subunit is present in intestinal epithelium, and therefore both KCNQ1:KCNE1 channels and KCNQ1 homomeric channels without KCNE subunit could also in principle occur in colon epithelium. We therefore tested for a possible effect of E2 on currents elicited in CHO cells transfected with KCNQ1 on its own and KCNQ1 accompanied by KCNE1 (Supplementary Figs 2S and 3S). The currents generated in CHO cells by these transfections had the expected morphology (Bendahhou et al. 2005), with acquisition of voltage dependence for both forms of channels and markedly slowed activation for the KCNQ1:KCNE1 complex. As shown in Supplementary Figs 2SB and 3SB, and summarized in Fig. 10, neither of these channel forms was affected by E2 addition.

The fast effect that E2 exerts on colonic secretion through inhibition of the KCNQ1:KCNE3 is mediated by sex-specific activation of PKCδ (O'Mahony et al. 2007). Residue S82 of KCNE3 has been shown to be a functional site for PKCδ-promoted phosphorylation and modulation of the activity of KCNE3 (Abbott et al. 2006). We have explored by site-directed mutagenesis whether S82 is required for the inhibitory effect of E2 on KCNQ1:KCNE3 channels. Transfection of KCNQ1 and KCNE3-S82A led to currents very much like those obtained with the non-mutated auxiliary subunit (Fig. 11A and B). One difference with the KCNQ1:KCNE3 channels is that KCNQ1:KCNE3-S82A run down much more rapidly than the non-mutated channels (Fig. 11C). Nevertheless, once rundown was at its slowest, addition of E2 was without effect on the residual current (Fig. 11C and also Fig. 10). Also the kinetics of fast activation of KCNQ1:KCNE3-S82A channels was not altered in the presence of E2 (Fig. 11D and E).

Figure 11. Effect of 17β-oestradiol (E2) on currents mediated by the potassium channel complex formed by KCNQ1 and the mutant KCNE3-S82A β-subunit.

Figure 11

Open in a new tab

A, family of currents elicited in CHO cells transfected with KCNQ1 and KCNE3-S82A cDNA taken immediately after breaking into whole cell. Currents were elicited by square pulses taking the membrane from a holding potential of −80 mV to voltages between −100 and 80 mV in 20 mV steps. Post-pulse was to −30 mV. B, end of pulse current–voltage relation for experiments as those shown in A. Means ± SEM of 10 experiments. A train of 3 s pulse stimulations consisting of 500 ms square pulses to −40, 0, 40 and 100 mV was given to monitor current rundown and test the effect of E2. The holding potential was −70 mV and the period 10 s. In C, currents taken at the end of pulses to −40 and 0 mV of the train of pulses are plotted for the duration of the experiment, with an arrow showing the time of 100 nm E2 addition. E, currents elicited at the different voltages during the stimulus train taken 20 s before and 10 or 40 s after E2 addition. D, times to reach 90% of maximal current as function of voltage taken 20 s before and 40 s after E2 addition (means ± SEM, n = 5).

Discussion

In colonic epithelia, Cl− secretion stimulated by either Ca2+- or cAMP-dependent secretagogues requires parallel activation of basolateral K+ channels, which are responsible for recycling K+ transported into the cell by basolateral Na+–K+–2Cl− cotransporters and Na+–K+–ATPase pumps (Kunzelmann & Mall, 2002, Heitzmann & Warth, 2008). Two types of K+ channels have been identified in the basolateral membrane of rat colonic crypts: a Ca2+-activated intermediate conductance K+ channel (Kunzelmann & Mall, 2002), and a cAMP-activated very small conductance (3 pS) K+ channel (Schroeder et al. 2000). Pharmacological data have indicated the latter to be KCNQ1 channels and that this channel is important for cAMP-dependent Cl− secretion in colon (Schroeder et al. 2000).

Recent studies have shown expression of KCNQ1 in colonic crypt cells where it co-localizes with the KCNE3 regulatory subunit. Co-expression of KCNQ1 with KCNE3 produces a constitutively open channel complex that is active at the negative membrane voltage exhibited by colonic epithelial cells (Schroeder et al. 2000). The KCNE3 subunit has been shown to be critical for the KCNQ1 role in supporting Cl− secretion in intestine and trachea (Preston et al. 2010). Therefore, co-expression of KCNQ1 channels with the KCNE3 subunit is an important factor in regulating epithelial Cl− secretion.

In this study, we report a sex difference in the expression of KCNE1 and KCNE3 in rat distal colonic crypt cells. At the transcript level, male colonic cells showed a 5-fold and 10-fold higher level of KCNE1 and KCNE3 mRNA, respectively, compared to female crypt cells. At the protein level, this difference was even higher with a 6-fold and 13-fold higher protein expression of KCNE1 and KCNE3, respectively, in male cells compared to female. Interestingly, no sex difference was observed in the expression levels of the KCNQ1 channel in either mRNA or protein expression. No expression of KCNE2 subunit was found in either male or female crypt cells.

Since co-assembly of KCNQ1 channels with KCNE3 leads to active channels at negative membrane potentials exhibited by colonic crypt cells, we examined the level of association between these channel proteins. Male colonic crypts express more than twice the amount of KCNQ1:KCNE3 complex channels compared to female colonic crypts.

In female rat colonic crypts, the expression of KCNQ1 and KCNE3 was also found to be dependent on oestrous cycle. During prooestrus KCNQ1 expression is at its lowest while KCNE3 is maximal, and this suggests that although KCNQ1 expression is low, the proportion of KCNQ1:KCNE3 complexes would be high. In contrast, at metaoestrus when KCNQ1 expression is maximal while KCNE3 is minimal, the amount of KCNQ1:KCNE3 complexes compared to other KCNE complexes or homomeric KCNQ1 complexes will be minimal. The variation in the degree of association between KCNQ1 and KCNE3 proteins in male and female crypts, and throughout the oestrous cycle in the female, points to an endocrine modulation of the channel complex assembly. Our finding that 17β-oestradiol promotes the dissociation of KCNQ1:KCNE3 in female crypts and not in male supports this conclusion. Since KCNE3 regulates the gating properties of KCNQ1 channels, we examined if the sex difference in KCNE3 expression and association with KCNQ1 lead to differences in the electrical properties of this channel between male and female colonic crypts. In male colonic crypts, whole-cell current showed the typical characteristics of the KCNQ1:KCNE3 channel complex with instantaneous activation and rapid deactivation, the I–V relationship was linear with no outward rectification and significant currents were active at voltages more negative than −50 mV. In contrast, whole-cell currents from female colonic crypts showed a much slower activation kinetics, the I–V relationship showed strong outward rectification and voltage dependence reminiscent of the properties of homomeric KCNQ1 channels or KCNQ1:KCNE1 complexes. These results suggest that in male colonic crypt cells KCNQ1:KCNE3 represents the main KCNQ1 current while female colonic crypt cells express a mixed population of homomeric KCNQ1 and heteromeric KCNQ1:KCNE1 and KCNQ1:KCNE3 channel complexes, although the latter may represent only a small fraction of the KCNQ1 conductance.

We also examined the properties of the basolateral K+ conductance in apically permeabilized colonic epithelia to determine sex differences in the KCNQ1 currents. Male epithelia showed basolateral K+ currents with a linear I–V relationship characteristic of KCNQ1:KCNE3 complexes. In contrast, basolateral K+ currents from female colonic epithelia showed voltage dependence and outward rectification. These data suggest that at the cellular and tissue level, sex differences in KCNE3 expression lead to marked differences in the electrical properties of KCNQ1 currents.

Association of KCNQ1 channels with KCNE subunits not only affects the gating properties of the channel, but also its pharmacological profile (Robbins, 2001; McCrossan & Abbott, 2004; Jespersen et al. 2005). Several studies have reported that association of KCNQ1 with KCNE increases the sensitivity to chromanol 293B (Lerche et al. 2000; Unsöld et al. 2000). In this study, we observed a significant sex difference in the sensitivity to chromanol 293B of whole-cell currents in crypt cells, apically permeabilized epithelia and intact colonic epithelia. Male colonic cells and tissues showed a 10-fold higher sensitivity to chromanol 293B compared to female cells and tissues. This difference in sensitivity to chromanol 293B is similar to that reported between KCNQ1 and KCNQ1:KCNE3 channels expressed in Xenopus oocytes (Lerche et al. 2000; Unsöld et al. 2000). Recent studies have reported that chromanol can also block the cystic fibrosis transmembrane conductance regulator (CFTR) Cl− channel (Liao et al. 2005); therefore, in intact colonic epithelia we also tested the sensitivity of short-circuit currents to inhibition by HMR-1556. This compound has been shown to be more potent and selective than chromanol 293B in blocking KCNQ1 channels and also displays a 10-fold higher potency on channels associated with KCNE subunits (Lerche et al. 2000). Again, male colonic epithelial short-circuit currents showed a 10-fold higher sensitivity to HMR-1556 compared to female colonic epithelia.

Following the discovery that KCNQ1 co-assembles with KCNE subunits to form heteromeric channels there was much excitement about the fundamental changes of KCNQ1 channel properties brought about by these subunit interactions. Apart from the modulation of electrical and pharmacological properties of KCNQ1, several studies have reported that association with KCNE subunits regulates modulation of KCNQ1 channels by several factors. KCNE1 β subunits can dissociate from KCNQ1 once they are at the plasma membrane (Poulsen & Klaerke, 2007). Deletion of KCNE2 β subunits disrupts polarized trafficking resulting in misrouting of KCNQ1 from apical to basolateral membranes in parietal cells (Roepke et al. 2011). KCNE1 mediates dynamin-dependent endocytosis of the heart IKs channel (KCNQ1:KCNE1 complex), and stimulation of PKC with the phorbol ester phorbol 12-myristate 13-acetate (PMA) increased KCNQ1:KCNE1 endocytosis in CHO cells expressing wild-type dynamin 2 (Kanda et al. 2011). Homomeric KCNQ1 channels show little regulation by temperature but when coexpressed with KCNE subunits they become highly sensitive to temperature (Unsöld et al. 2000). The KCNQ1 channels are also active at room temperature in crypt cells but the currents are quite small and difficult to resolve from other crypt cell conductances (Schroeder et al. 2000). We found the channel current in isolated crypts to be more easily resolved and stable at 37°C. Perhaps the difficulty in patch-clamping native tissue at 37°C has prevented many researchers from performing this type of ‘physiological’ experiment. The channels in heterologous expression, on the other hand, show robust activity at room temperature and have been studied thus in the majority of the reports in the literature.

Intracellular acidification also leads to a reduction of most K+ currents, and this is also the case for KCNQ1. However, co-expression with KCNE1 has been reported to reverse this effect of intracellular acidification and to mediate a net KCNQ1 current increase (Unsöld et al. 2000). In Xenopus oocytes, stimulation of rat KCNQ1 currents by an increase in intracellular Ca2+ requires co-expression of either KCNE1 or KCNE3. Kurokawa et al. (2003) demonstrated in CHO cells that cAMP mediated KCNQ1 phosphorylation is independent of co-assembly with KCNE1, but transduction of the channel phosphorylation into increased channel activity requires the presence of KCNE1.

We have used a CHO cell expression system for KCNQ1:KCNE3 to further understand the action of E2 on the channel complex. CHO cells have been used before in KCNQ1:KCNE3 functional assays (Melman et al. 2001). We show, on the other hand, that CHO cells express PKCδ, which we have proposed as the key player in the sex-specific signalling of the rapid oestrogen effect in colonic epithelium (O'Mahony et al. 2007). Our results indicate that E2 inhibits currents mediated by KCNQ1:KCNE3 expressed in CHO cells. The effect is rapid, consistent with a non-genomic action and requires the presence of the KCNE3 subunit, as there is no observable effect when KCNQ1 is expressed on its own. The currents induced by co-expression of KCNE3 and KCNQ1 had the characteristics time and voltage independence expected for these channels. Strikingly, however, there was a radical change in voltage dependence brought about by E2. The currents become slow activating and markedly voltage dependent, and reminiscent of those seen when KCNQ1 is expressed in the absence of an auxiliary subunit. The marked voltage dependence of the currents post-E2 treatment has as a consequence that a major collapse in conductance occurs at physiologically relevant potentials (Giraldez et al. 1988).

As KCNE1 is also expressed in the intestinal epithelium, we tested the effect of E2 on the slowly activating KCNQ1:KCNE1 channels that are known to mediate currents responsible for slow repolarization of cardiac cells. E2 had no effect on KCNQ1:KCNE1-mediated currents in the CHO expression system pointing to a specificity for the oestrogen action dependent on the presence of KCNE3.

All KCNE subunits possess a consensus site for PKC-dependent phosphorylation in a region near their only transmembrane domain which is formed by a serine residue and three basic amino acids (RS82RK in KCNE3) and its potential importance in phosphorylation has been suggested by mutagenesis (Abbott et al. 2006). Currents elicited by KCNQ1:KCNE3-S82A had all the hallmarks of non-mutated channels, but exhibited a markedly faster rundown upon breaking into the whole-cell recording configuration mode. Addition of E2, however, was without effect showing that S82 is essential for oestrogen action and suggesting that phosphorylation at that residue might be part of its mechanism of action. We hypothesize that the effect of E2 on KCNQ1:KCNE3 might be to induce the rapid dissociation of the two subunits leading to kinetics more akin to that associated with expression of KCNQ1 on its own. This would not necessarily involve a complete physical separation, as subtle mutations in KCNE3 can lead to a functional uncoupling of KCNQ1 and its auxiliary subunit (Melman et al. 2002b). Nevertheless, the sex-specific dissociation of KCNQ1 and KCNE3 after E2 treatment that we document here could be related to the changes in channel kinetics observed in the heterologous expression system. The hypothesis of a dissociation of KCNQ1 and KCNE3 under the action of E2 would also explain the differences in rectification observed in the K+ currents between males and oestrous female colonic epithelium or isolated crypts, as well as in pharmacological sensitivity.

In physiological terms, this study demonstrates that the pharmacology and gating properties of KCNQ1 in colonic epithelia are strongly dependent on sex-regulated expression of KCNE subunits. This subunit-specific pharmacology suggests that drugs that are targeted to KCNQ1 in particular organs can be made more specific by considering subunit characteristics.

Because proper function of the KCNQ1:KCNE3 channel is essential for maintaining the electrical driving force for electrolyte secretion, the female sex specificity of the anti-secretory response to 17β-oestradiol has implications for the development and use of new pharmacological tools in the treatment of Cl− secretory disorders where oestrogen has been shown to have a modulatory function as in bacteria-induced secretory diarrhoea (Alzamora et al. 2011) and in cystic fibrosis, the so-called CF ‘gender gap’ (Chotirmall et al. 2010).

Acknowledgments

This work was supported by The Higher Education Authority of Ireland (HEA) PRTLI Cycle 4, National Biophotonics & Imaging Platform of Ireland. Grants Fondecyt 1100859 and Conicyt D21080596 and 24090147 (to VB) are also acknowledged. CECS is supported by the PFB Chile. We are grateful to Carolina Añazco for continued help.

Glossary

Abbreviations

ISC

short-circuit current

IK

basolateral potassium current

CFTR

cystic fibrosis transmembrane conductance regulator

Author contributions

All authors were involved in the conception and design, analysis and interpretation of data. R.A., F.O'M., F.S. and B.J.H. drafted the article and F.S. and B.J.H. made the final revisions of the version to be published. The experiments on rat colonic crypts were carried out by R.A., F.O'M. and R.R.-M. in the RCSI Molecular Medicine Laboratories, Dublin, Ireland and the CHO cell patch-clamp experiments were carried out by V.B. in the CECS laboratories, Valdivia, Chile.

Supplementary material

Figure 1S

Figure 2S

Figure 3S

Figure 4S

tjp0589-5091-SD1.docx (373.7KB, docx)

As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors

References

  1. Abbott GW, Butler MH, Goldstein SA. Phosphorylation and protonation of neighboring MiRP2 sites: function and pathophysiology of MiRP2-Kv3.4 potassium channels in periodic paralysis. FASEB J. 2006;20:293–301. doi: 10.1096/fj.05-5070com. [DOI] [PubMed] [Google Scholar]
  2. Alzamora R, O'Mahony F, Harvey BJ. Estrogen inhibits chloride secretion caused by cholera and Escherichia coli enterotoxins in female rat distal colon. Steroids. 2011;76:867–876. doi: 10.1016/j.steroids.2011.04.016. [DOI] [PubMed] [Google Scholar]
  3. Arrighi I, Bloch-Faure M, Grahammer F, Bleich M, Warth R, Mengual R, Drici MD, Barhanin J, Meneton P. Altered potassium balance and aldosterone secretion in a mouse model of human congenital long QT syndrome. Proc Natl Acad Sci U S A. 2001;98:8792–8797. doi: 10.1073/pnas.141233398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, Romey G. KVLQT1 and IsK (minK) proteins associate to form the IKs cardiac potassium current. Nature. 1996;384:78–80. doi: 10.1038/384078a0. [DOI] [PubMed] [Google Scholar]
  5. Bendahhou S, Marionneau C, Haurogne K, Larroque MM, Derand R, Szuts V, Escande D, Demolombe S, Barhanin J. In vitro molecular interactions and distribution of KCNE family with KCNQ1 in the human heart. Cardiovasc Res. 2005;67:529–538. doi: 10.1016/j.cardiores.2005.02.014. [DOI] [PubMed] [Google Scholar]
  6. Chotirmall SH, Greene CM, Oglesby IK, Thomas W, O'Neill SJ, Harvey BJ, McElvaney NG. 17β-Estradiol inhibits IL-8 in cystic fibrosis by up-regulating secretory leucoprotease inhibitor. Am J Respir Crit Care Med. 2010;182:62–72. doi: 10.1164/rccm.201001-0053OC. [DOI] [PubMed] [Google Scholar]
  7. Cid LP, Niemeyer MI, Ramírez A, Sepúlveda FV. Splice variants of a ClC-2 chloride channel with differing functional characteristics. Am J Physiol Cell Physiol. 2000;279:C1198–C1210. doi: 10.1152/ajpcell.2000.279.4.C1198. [DOI] [PubMed] [Google Scholar]
  8. Condliffe SB, Doolan CM, Harvey BJ. 17β-Oestradiol acutely regulates Cl− secretion in rat distal colonic epithelium. J Physiol. 2001;530:47–54. doi: 10.1111/j.1469-7793.2001.0047m.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dedek K, Waldegger S. Colocalization of KCNQ1/KCNE3 channel subunits in the mouse gastrointestinal tract. Pflugers Arch. 2001;442:896–902. doi: 10.1007/s004240100609. [DOI] [PubMed] [Google Scholar]
  10. Díaz M, Sepúlveda FV. Characterisation of Ca2+-dependent inwardly rectifying K+ currents in HeLa cells. Pflugers Arch. 1995;430:168–180. doi: 10.1007/BF00374647. [DOI] [PubMed] [Google Scholar]
  11. Dilly KW, Kurokawa J, Terrenoire C, Reiken S, Lederer WJ, Marks AR, Kass RS. Overexpression of β2-adrenergic receptors cAMP-dependent protein kinase phosphorylates and modulates slow delayed rectifier potassium channels expressed in murine heart: evidence for receptor/channel co-localization. J Biol Chem. 2004;279:40778–40787. doi: 10.1074/jbc.M406010200. [DOI] [PubMed] [Google Scholar]
  12. Doolan CM, Harvey BJ. Modulation of cytosolic protein kinase C and calcium ion activity by steroid hormones in rat distal colon. J Biol Chem. 1996;271:8763–8767. doi: 10.1074/jbc.271.15.8763. [DOI] [PubMed] [Google Scholar]
  13. Field M. Intestinal ion transport and the pathophysiology of diarrhea. J Clin Invest. 2003;111:931–943. doi: 10.1172/JCI18326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Giraldez F, Sepúlveda FV, Sheppard DN. A chloride conductance activated by adenosine 3′,5′-cyclic monophosphate in the apical membrane of Necturus enterocytes. J Physiol. 1988;395:597–623. doi: 10.1113/jphysiol.1988.sp016937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Heitzmann D, Warth R. Physiology and pathophysiology of potassium channels in gastrointestinal epithelia. Physiol Rev. 2008;88:111911–111982. doi: 10.1152/physrev.00020.2007. [DOI] [PubMed] [Google Scholar]
  16. Jespersen T, Grunnet M, Olesen SP. The KCNQ1 potassium channel: from gene to physiological function. Physiology. 2005;20:408–416. doi: 10.1152/physiol.00031.2005. [DOI] [PubMed] [Google Scholar]
  17. Kanda VA, Purtell K, Abbott GW. Protein Kinase C downregulates IKs by stimulating KCNQ1-KCNE1 potassium channel endocytosis. Heart Rhythm. 2011;8:1641–1647. doi: 10.1016/j.hrthm.2011.04.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kunzelmann K, Hübner M, Schreiber R, Levy-Holzman R, Garty H, Bleich M, Warth R, Slavik M, von Hahn T, Greger R. Cloning and function of the rat colonic epithelial K+ channel KVLQT1. J Membr Biol. 2001;179:155–164. doi: 10.1007/s002320010045. [DOI] [PubMed] [Google Scholar]
  19. Kunzelmann K, Mall M. Electrolyte transport in the mammalian colon: mechanisms and implications for disease. Physiol Rev. 2002;82:245–289. doi: 10.1152/physrev.00026.2001. [DOI] [PubMed] [Google Scholar]
  20. Kurokawa J, Chen L, Kass RS. Requirement of subunit expression for cAMP-mediated regulation of a heart potassium channel. Proc Natl Acad Sci USA. 2003;100:2122–2127. doi: 10.1073/pnas.0434935100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lerche C, Seebohm G, Wagner CI, Scherer CR, Dehmelt L, Abitbol L, Gerlach U, Brendel J, Attali B, Busch AE. Molecular impact of MinK on the enantiospecific block of IKs by chromanols. Br J Pharmacol. 2000;131:1503–1506. doi: 10.1038/sj.bjp.0703734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Liao T, Wang L, Halm ST, Lu L, Fyffe RE, Halm DR. K+ channel KVLQT1 located in the basolateral membrane of distal colonic epithelium is not essential for activating Cl− secretion. Am J Physiol Cell Physiol. 2005;289:C564–C575. doi: 10.1152/ajpcell.00561.2004. [DOI] [PubMed] [Google Scholar]
  23. Mazhari R, Nuss HB, Armoundas AA, Winslow RL, Marban E. Ectopic expression of KCNE3 accelerates cardiac repolarization and abbreviates the QT interval. J Clin Invest. 2002;109:1083–1090. doi: 10.1172/JCI15062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. McCrossan ZA, Abbott GW. The MinK-related peptides. Neuropharmacology. 2004;47:787–821. doi: 10.1016/j.neuropharm.2004.06.018. [DOI] [PubMed] [Google Scholar]
  25. McNamara B, Winter DC, Cuffe JE, O'Sullivan GC, Harvey BJ. Basolateral K+ channel involvement in forskolin-activated chloride secretion in human colon. J Physiol. 1999;519:251–260. doi: 10.1111/j.1469-7793.1999.0251o.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. McNamara B, Winter DC, Cuffe J, Taylor C, O'Sullivan GC, Harvey BJ. Rapid activation of basolateral potassium transport in human colon by oestradiol. Br J Pharmacol. 2000;131:1373–1378. doi: 10.1038/sj.bjp.0703714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Melman YF, Domènech A, de la Luna S, McDonald TV. Structural determinants of KVLQT1 control by the KCNE family of proteins. J Biol Chem. 2001;276:6439–6444. doi: 10.1074/jbc.M010713200. [DOI] [PubMed] [Google Scholar]
  28. Melman YF, Krumerman A, McDonald TV. KCNE regulation of KvLQT1 channels: structure-function correlates. Trends Cardiovasc Med. 2002a;12:182–187. doi: 10.1016/s1050-1738(02)00158-5. [DOI] [PubMed] [Google Scholar]
  29. Melman YF, Krumerman A, McDonald TV. A single transmembrane site in the KCNE-encoded proteins controls the specificity of KvLQT1 channel gating. J Biol Chem. 2002b;277:25187–25194. doi: 10.1074/jbc.M200564200. [DOI] [PubMed] [Google Scholar]
  30. O'Mahony F, Alzamora R, Betts V, LaPaix F, Carter D, Irnaten M, Harvey BJ. Female gender-specific inhibition of KCNQ1 channels and chloride secretion by 17β-estradiol in rat distal colonic crypts. J Biol Chem. 2007;282:24563–24573. doi: 10.1074/jbc.M611682200. [DOI] [PubMed] [Google Scholar]
  31. O'Mahony F, Alzamora R, Chung HL, Thomas W, Harvey BJ. Genomic priming of the antisecretory response to estrogen in rat distal colon throughout the estrous cycle. Mol Endocrinol. 2009;23:1885–1899. doi: 10.1210/me.2008-0248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Poulsen AN, Klaerke DA. The KCNE1 β-subunit exerts a transient effect on the KCNQ1 K+ channel. Biochem Biophys Res Commun. 2007;363:133–139. doi: 10.1016/j.bbrc.2007.08.146. [DOI] [PubMed] [Google Scholar]
  33. Preston P, Wartosch L, Günzel D, Fromm M, Kongsuphol P, Ousingsawat J, Kunzelmann K, Barhanin J, Warth R, Jentsch TJ. Disruption of the K+ channel beta-subunit KCNE3 reveals an important role in intestinal and tracheal Cl− transport. J Biol Chem. 2010;285:7165–7175. doi: 10.1074/jbc.M109.047829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Robbins J. KCNQ potassium channels: physiology, pathophysiology, and pharmacology. Pharmacol Ther. 2001;90:1–19. doi: 10.1016/s0163-7258(01)00116-4. [DOI] [PubMed] [Google Scholar]
  35. Roepke TK, King EC, Purtell K, Kanda VA, Lerner DJ, Abbott GW. Genetic dissection reveals unexpected influence of β subunits on KCNQ1 K+ channel polarized trafficking in vivo. FASEB J. 2011;25:727–736. doi: 10.1096/fj.10-173682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Schroeder BC, Waldegger S, Fehr S, Bleich M, Warth R, Greger R, Jentsch TJ. A constitutively open potassium channel formed by KCNQ1 and KCNE3. Nature. 2000;403:196–199. doi: 10.1038/35003200. [DOI] [PubMed] [Google Scholar]
  37. Schultheiss G, Lan Kocks S, Diener M. Methods for the study of ionic currents and Ca2+ signals in isolated colonic crypts. Biol Proced Online. 2002;3:70–78. doi: 10.1251/bpo25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tristani-Firouzi M, Sanguinetti MC. Voltage-dependent inactivation of the human K+ channel KVLQT1 is eliminated by association with minimal K+ channel (minK) subunits. J Physiol. 1998;510:37–45. doi: 10.1111/j.1469-7793.1998.037bz.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Unsöld B, Kerst G, Brousos H, Hübner M, Schreiber R, Nitschke R, Greger R, Bleich M. KCNE1 reverses the response of the human K+ channel KCNQ1 to cytosolic pH changes and alters its pharmacology and sensitivity to temperature. Pflugers Arch. 2000;441:368–378. doi: 10.1007/s004240000434. [DOI] [PubMed] [Google Scholar]
  40. Vallon V, Grahammer F, Volkl H, Sandu CD, Richter K, Rexhepaj R, Gerlach U, Rong Q, Pfeifer K, Lang F. KCNQ1-dependent transport in renal and gastrointestinal epithelia. Proc Natl Acad Sci U S A. 2005;102:17864–17869. doi: 10.1073/pnas.0505860102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Warth R, Riedemann N, Bleich M, van Driessche W, Busch AE, Greger R. The cAMP-regulated and 293B-inhibited K+ conductance of rat colonic crypt base cells. Pflugers Arch. 1996;432:81–88. doi: 10.1007/s004240050108. [DOI] [PubMed] [Google Scholar]
  42. Yang Y, Sigworth FJ. Single-channel properties of IKs potassium channels. J Gen Physiol. 1998;112:665–678. doi: 10.1085/jgp.112.6.665. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

tjp0589-5091-SD1.docx (373.7KB, docx)

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES