A Novel Emerin/Nesprin-3 Interaction Mediates Nuclear Size Changes Induced by Oncogenic KRAS in Pancreatic Cancer Cells

Mutant KRAS drives increased interaction between Emerin and Nesprin-3

Given that Emerin’s protein interactions are critical for its function, we sought to identify binding partners that may contribute to Emerin’s role in nuclear morphology observed in mKRAS expressing cells.⁷ To address this question and define the mKRAS driven Emerin interactome, we performed a BioID in the doxycycline (Dox) inducible KRAS^G12D 1012U cell line.^19–21 Partner protein interactions in the absence (−Dox) and presence (+Dox) of mKRAS were quantified and measured as label free quantifications (LFQ). Analysis revealed 1008 Emerin binding partners influenced by mKRAS, of which 326 of these Emerin-protein interactions were increased (Figure 1A, Supplementary Table S1). From these data, we identified Nesprin-3 as a unique and enriched Emerin binding partner exclusive to mKRAS cells (Figure 1A). Furthermore, utilizing the BioID data, we specifically examined the interactions between Emerin and several nuclear and nuclear envelope proteins known to regulate nuclear morphology.²² Of these proteins, Eesprin-3 was the most upregulated in its interaction with Emerin (Figure 1B). While Emerin is a known interactor and component of the LINC complex,²³ the interaction between Emerin and Nesprin-3 has not been previously reported. To see if this increased interaction was prevalent across other known LINC complex members, we examined the change in interaction between Emerin and the other Nesprin isoforms (Syne1/Syne2) and Sun proteins. Interestingly, the other Nesprin isoforms (Nesprin 1 and 2) were either not detected, or had no change in interaction with emerin under mKRAS conditions (Figure 1B, Syne1/Syne2, respectively). Similarly, both Sun1 and Sun2 experienced a decrease in their interaction frequency with Emerin upon mKRAS induction (Figure 1B). Taken together, these findings suggest a novel and unique interaction between Nesprin-3 and Emerin under mKRAS conditions. While our BioID identifies Emerin/Nesprin-3 as a mKRAS-induced interaction in pancreatic cancer cells, Nesprin-3 localization to the nuclear envelope is generally considered Sun/KASH-dependent,¹⁸ and our data do not test whether Emerin can substitute for Sun in this role. To validate the BioID findings, we performed an Emerin co-immunoprecipitation and confirmed Nesprin-3/Emerin interaction in mKRAS (+Dox) cells (Figure 2A). Further we examined this interaction using proximity ligation assays (PLA). These studies showed increased Emerin/Nesprin-3 interaction in the mKRAS-overexpressing cells compared to cells without KRAS overexpression, suggesting mKRAS enriches this interaction (Fig. 2B and C). As expected, single antibody controls did not show any positive PLA foci (Supplementary Figure S1). Finally, we sought to evaluate emerin/nesprin-3 colocalization. First, we characterized the nuclear distribution of Emerin and Nesprin-3 with immunofluorescence and confirmed abundant peripheral colocalization of Nesprin-3 and Emerin signal intensity with line-scan analyses (Fig. 3A and B). Quantification of Emerin and Nesprin-3 intensity at the nuclear periphery revealed significant peripheral enrichment in mKRAS (+Dox) expressing cells (Figure 3C). An increase in these proteins at the nuclear periphery supports the concept that altered localization of these proteins could be involved in changes in nuclear size in mKRAS-overexpressing cells. Nesprin-3 and Emerin colocalization and peripheral enrichment driven by mKRAS was confirmed in a secondary Dox-inducible mKRAS line, 4292F (Supplementary Figure S2). As expected, mKRAS expression resulted in enriched NE localization of both Emerin and Nesprin-3 (Supplementary Figure S2C). Overall, these results suggest that mKRAS drives this novel interaction between Nesprin-3 and Emerin at the nuclear periphery.

Mutant KRAS increases Nesprin-3 expression levels

To understand how mKRAS influences Nesprin-3 expression, we profiled the 1012U cell transcriptome and epigenome via RNA-seq and ChIP-seq, respectively, in KRAS WT and mutant conditions (−Dox vs +Dox cells). Analysis of the same nuclear proteins presented in Figure 1, revealed mKRAS influences gene expression of several nuclear regulators, of which Nesprin-3 shown under its gene name Syne3, was significantly increased (Figure 4A). We validated our initial RNA-seq data in 1012U cells by qRT-PCR for Nesprin-3. Our results indicate KRAS significantly upregulated RNA expression levels of Nesprin-3 (Figure 4B), which was confirmed in 4292F cells (Supplementary Figure S3A). Increased RNA expression was accompanied by increased protein expression in both lines (Figure 4C, Supplementary Figure S3B). Consistent with our prior observation that Emerin levels also rise upon KRAS expression,⁷ these findings suggest coordinated upregulation of both proteins, along with their increased interaction under mKRAS induction.

Epigenomic analysis of active histone marks (H3K27Ac, H3K4me1, H3K4me3)²⁴ showed enrichment of these modifications across the Nesprin-3 promoter in mKRAS cells (Figure 4D). Transcription factor motif analysis using the JASPAR algorithm²⁵ identified the specificity protein (SP) and Kruppel-like factors (KLF) families of transcription factors consensus binding sites in the Nesprin-3 promoter. Using RNA-seq from 1012U cells revealed several of these transcription factors are upregulated under mKRAS, including SP5, KLF5, and KLF15 having the greatest increase (Supplementary Figure S4A). Given that SP5 and KLF15 have been shown to be repressors,²⁶ we selected KLF5 as the target transcription factor driving Nesprin-3 expression. Increased KLF5 gene and protein expression under mKRAS was confirmed via qRT-PCR and Western blotting in 1012U and 4292F cells (Supplementary Figure S3C to E). We cross-referenced with RNA-seq from human PDAC lines, AsPC1 and L3.6pl,²⁷ and found KLF5 was elevated in these cells compared to the other members of the SP/KLF family (Supplementary Figure S4B). Furthermore, analysis of PDAC cases, generated by the National Cancer Institute Clinical Proteomic Tumor Analysis Consotrtium (CPTAC), revealed that KLF5 expression was increased in mKRAS tumors compared to KRAS wild-type tumors (Supplementary Figure S3F).²⁸ ChIP-seq data showed KLF5 binding to the Nesprin-3 promoter in these mKRAS PDAC cells confirming that Nesprin-3 is direct target of KLF5 (Figure 4E).

To validate KLF5 mediated regulation of Nesprin-3, we utilized RNA-seq from human PDAC cells with knockdown of KLF5. Importantly, KLF5 depletion in mKRAS lines results in significantly lower Nesprin-3 RNA levels, whereas depletion in KRAS WT cells (BxPC3) did not affect Nesprin-3 expression (Figure 4F). We confirmed these results in L3.6pl using two independent targeting siRNAs (Figure 4G, Supplementary Figure S5A). In alignment with these findings, overexpression of KLF5 in cells with knockdown of mKRAS (iPanc-1) demonstrated that KLF5 can increase Nesprin-3 levels in the absence of mKRAS (Supplementary Figure S5B). Taken together, these results suggest that mKRAS uses the transcription factor, KLF5 as an effector to regulate Nesprin-3 expression in PDAC cells.

Nesprin-3 phenocopies Emerin’s effect on nuclear size

To understand the function and importance of this novel Emerin–Nesprin-3 interaction in nuclear morphology, we performed Nesprin-3 modulation experiments. First, to implicate Nesprin-3 in the nuclear morphology changes observed in mKRAS cells, we analyzed immunofluorescence experiments in mKRAS 1012U cells with siRNA mediated Nesprin-3 knockdown. Like Emerin,⁷ loss of Nesprin-3 results in increased nuclear surface area and volume (Figure 5A and B). Specifically, depletion of Nesprin-3 significantly increased the median nuclear surface area and volume (Figure 5C). Enlarged nuclear size in the presence of siRNA mediated knockdown of Nesprin-3 was confirmed using a second independent siRNA (Supplementary Figure S6), and in the mKRAS 4292F cells (Supplementary Figure S7). Similarly, to confirm Nesprin-3’s role in nuclear size changes, we overexpressed Nesprin-3 in 1012U WT cells (−Dox) (Figure 5D and E). Interestingly, Nesprin-3 overexpression phenocopies the mKRAS induced nuclear morphology changes, resulting in significantly smaller nuclei (Figure 5F).

To confirm Nesprin-3’s role is consistent in human models of PDAC, these studies were performed in two independent cell lines. First, siRNA mediated depletion of Nesprin-3 in the mKRAS human PDAC cell line, L3.6pl, resulted in a significant increase in nuclear size (Supplementary Figure S8A to D). To complement the mouse inducible mKRAS cells, Nesprin-3’s role under mKRAS was assessed in a doxycycline inducible shRNA targeting KRAS human cell line, iPanc-1 (Supplementary Figure S8E). As expected, silencing of mKRAS increased nuclear surface area and volume (Supplementary Figure S8G). Interestingly, nuclear morphology in the absence of mKRAS (+Dox) could be rescued with Nesprin-3 overexpression (Supplementary Figure S8E to G). Taken together these studies highlight the role of Nesprin-3 in mediating nuclear size in several complementary mKRAS models.

Having shown that Nesprin-3 levels are regulated by KLF5, we next aimed to investigate if these nuclear morphology changes can be induced upstream of Nesprin-3 expression. First, Nesprin-3 expression was examined in the presence of KLF5 overexpression in KRAS WT cells (−Dox). KLF5 overexpression upregulated Nesprin-3 at both RNA and protein levels (Supplementary Figure S9A to C). To examine the corresponding effect on nuclear size, nuclei were quantified following KLF5 overexpression (Supplementary Figure S9D). In immunofluorescence experiments, nuclear surface area and volume both decreased in cells overexpressing this transcription factor (Fig. S9E). Taken together, these data suggest that the KLF5-Nesprin-3 axis is both necessary and sufficient for regulating nuclear morphology and modulating its expression can phenocopy mKRAS conditions.

Nesprin-3 is required for mutant KRAS oncogenic functions

Given the nuclear morphology results, we aimed to determine if these changes induced by KRAS via Nesprin-3 are associated with genome re-organization using ChIP-seq in the 1012U cells for H3K4me1 and H3K27ac, chromatin post-translational modifications marking active enhancers. These are distal regulatory elements controlling promoter activity and gene expression, thus representing good indicators of global re-organization of the genome. To understand how mKRAS drives changes to the enhancer landscape, we performed GREAT analysis²⁹ on H3K4me1 and H3K27Ac peaks unique to WT KRAS (1012U −Dox) and mKRAS (1012U +dox) conditions. Specifically, GREAT analysis identified 67,164 regulatory elements unique to WT KRAS cells and 63,962 elements unique to mKRAS cells (Supplementary Table S2). When mapping these regions to the genome, we identified subsets of enhancer associated genes unique to WT and mKRAS conditions (Supplementary Figure S10A). To characterize the functions of the mKRAS enhancer associated genes we performed KEGG pathway analysis (Supplementary Table S3).³⁰ As anticipated, these genes were associated with pathways typically upregulated in cancer, such as MAPK signaling, Ras signaling and axon guidance among others (Supplementary Figure S10B).^31–35 We selected a subset of genes associated with our enriched pathways and validated differential H3K4me1 and H3K27Ac binding. Histone mark binding was assessed over a 5–30 kb region around the transcription start site to capture the majority of peaks mapped to the gene identified from GREAT analysis. Analysis of H3K4me1 peaks over this region shows a strong increase under mKRAS (+Dox) for most genes examined (Supplementary Figure S10C). Similar results were seen for H3K27Ac peaks (Supplementary Figure S10C), suggesting mKRAS driven enrichment of active enhancer marks at these genes. Examination of RNA-seq revealed that the enrichment of active histone marks is associated with a corresponding increase in gene expression under mKRAS (Supplementary Figure S10D). To determine the requirement of Nesprin-3 in the regulation of these genes downstream of mKRAS, we performed siRNA-mediation knockdown of Nesprin-3 in mKRAS cells (1012U +Dox). Importantly, loss of Nesprin-3 resulted in decreased RNA expression of these genes (Supplementary Figure S10E). Together, these results suggest mKRAS induced nuclear morphology changes are associated with global genome changes, and these gene expression changes can be reversed with the removal of Nesprin-3.

Next, to determine if Nesprin-3 could regulate KRAS’s oncogenic functions, we performed proliferation assays with Nesprin-3 modulation on three different mKRAS cell lines using two independent methods, CyQUANT and MTT. We found that, upon Nesprin-3 knockdown in both human and mouse cell lines (L3.6pl and 1012U +Dox) there is a statistically significant decrease in proliferation at 72 h compared to the baseline (0 h) (Supplementary Figure S11A and B). Western blot analyses were performed and confirmed protein reduction of Nesprin-3 at the 72-h time point (Supplementary Figure S11A and B). Complementarily, we performed proliferation assays in the iPanc-1 cell line. As expected, silencing of mKRAS decreases cell proliferation, which can be rescued with Nesprin-3 overexpression (Supplementary Figure S11C). Overexpression of Nesprin-3 was confirmed using Western blotting and KRAS silencing was confirmed using qRT-PCR at the 72 h time point (Supplementary Figure S11D and E). All together, these results confirm this new role of Nesprin-3 as an effector of oncogenic KRAS in pancreatic cancer cells.

Interaction between Emerin and Nesprin-3 is responsible for nuclear size regulation

Our previous work and the above presented data suggest both Emerin and Nesprin-3 are important players regulating nuclear morphology in PDAC. However, it remains unknown if the interaction between these two proteins is responsible for this effect. Emerin has previously been reported to interact with other Nesprin isoforms: Nesprin-1 and −2,^36–38 and given that Nesprin-3’s structure is highly similar to these isoforms^17,39,40 it is plausible similar protein domains are regulating this interaction. Previous work defining human Emerin interaction with the other Nesprin isoforms identified a point mutation (P183T) in Emerin disrupts the interaction with Nesprin-1.³⁶ Thus, we first sought to determine if this residue was responsible for the interaction with Nesprin-3. Since we are predominantly utilizing mouse systems, we generated a mouse homolog of the P183T mutation (P184T). Nuclear envelope localization and colocalization with Nesprin-3 was confirmed using immunofluorescence (Supplementary Figure S12A). To determine the extent of protein interaction with Nesprin-3, HA-tagged Emerin WT or P184T mutant were overexpressed in mKRAS 1012U cells (+Dox) and PLAs were performed utilizing the same antibodies used to test colocalization (Supplementary Figure S12B). Analysis of foci localization revealed predominantly nuclear foci, with some in the perinuclear space. For this reason, only nuclear foci were utilized for analysis. Despite significant expression of the Emerin P184T mutant (Supplementary Figure S12C), only the Emerin WT had significant interaction with Nesprin-3 compared to the empty vector control (Supplementary Figure S12D). Our results map for the first time the interaction between Emerin and Nesprin-3, identifying the key residue in Emerin responsible for this interaction.

Having defined the residue crucial for Emerin-Nesprin-3 interaction, we next wanted to investigate how disrupting this interaction will influence nuclear size. Either WT or P184T mutant Emerin was transfected into 1012U −Dox cells (Supplementary Figure S12E), and correct localization in the absence of mKRAS at the nuclear periphery was confirmed using immunofluorescence (Figure 6A). Intriguingly, overexpression of the P184T mutant did not result in decreases to nuclear surface area or volume compared to the EV control (Figure 6B). Importantly, overexpression of WT Emerin decreased both nuclear surface area and volume, as expected (Figure 6B). Taken together, these data highlight that by preventing Emerin–Nesprin-3 interaction we can prevent changes in nuclear morphology. Thus, our findings improve the understanding of molecular players and the mechanisms underlying nuclear morphology regulation in PDAC.

Plasmids

BioID2-only and BioID2-LaA pBabe-puro constructs were previously generated .²¹ N144-BioID2 pBabe-puro construct was previously generated.⁴⁵ Emerin was amplified from human cDNA by PCR and inserted into the BioID2-only pBabe puro plasmid by restriction enzyme digest with XhoI/SalI to make BioID2-Emerin pBabe-puro. pcDNA-FLAG-KLF5 plasmid was obtained from Addgene (RRID: 40918).⁴⁶ Vector pcDNA-HA2 was a gift from Scott Kaufman and was opened using HindIII and BamHI restriction sites. Wild-type emerin was amplified from 1012 U (−Dox) cDNA using primers GIB-Ms-Emd-F1 5′-tagggagacccaagcttatggacgactatgcggttttg/GIB-Ms-Emd-R1 5′-ccagctcctggcgcggatccgggatccatccagaaggggt. Gibson assembly (E2611S; NEB) was done to ligate the opened vector (5,401 bp) and fragment (814 bp) to make the final pcDNA-ms-Emd-HA2 plasmid. Gibson assembly was again utilized when creating Emerin P184T plasmid. Briefly, fragments were amplified from wild-type emerin plasmid (pcDNA-ms-Emd-HA2) using primer combinations; GIB-Ms-Emd-F2 5′-ctatagggagacccaagcttatgg/GIB-Ms-Emd-P184T-R1 5′-agaagaggtggaggatgtagTataatatgat (590 bp) and GIB-Ms-Emd-P184T-F1 5′-tgggcttatcatattatActacatcctcc/GIB-Ms-Emd-R2 5′-ACACTATAGAATAgggccctctag (351 bp). Vector and fragments were ligated together using Gibson assembly to make the final pcDNA-ms-Emd-P184T-HA2 plasmid.

Cell lines, cell culture and transfections

Standard incubation conditions of 37 °C and 5% CO₂ were used in all experiments. 1012U and 4292F cells were obtained from Dr Marina Pasca di Magliano (University of Michigan, Ann Arbor, MI, USA).¹⁹ iKRAS cells were cultured in RPMI 1640 (10–040-CV; Corning) with 10% Fetal Bovine Serum (35–010-CV, Corning) and doxycycline hyclate (D9891; Sigma-Aldrich) was used at 1 mg/mL to induce mKRAS. L3.6pl cells were cultured in MEM (10–010-CV; Corning) with 10% fetal bovine serum, 1X vitamins (11120052; Thermo Fisher Scientific), 1% L-glutamate (25030081; Thermo Fisher Scientific), 1% sodium pyruvate (25–000Cl; Corning) and 1% MEM NEAA (11140–050; Gibco). Doxycycline inducible shKRAS PANC-1 cells were cultured in DMEM (10–013-CV; Corning) with 10% fetal bovine serum as previously described.⁴⁷ siRNA transfections were performed with RNAiMAX (13778500; Invitrogen) or Dharmafect (T-2001–03; Horizon Discovery) per manufacturer’s suggestions. siRNAs used in these experiments were Syne3 FlexiTube (SI00835373; Qiagen), Syne3 SMARTpool (L-052180–01-0005; Dharmacon), KLF5 FlexiTube (SI04267641; Qiagen), KLF5 SMARTpool (L-013571–00-0005; Dharmacon), NT FlexiTube (1027281; Qiagen) and NT SMARTpool (D-001810–10-20; Dharmacon). Plasmid transfections were performed with X-Treme Gene (06366546001; Sigma-Aldrich). Briefly, cells were seeded at appropriate concentrations to ensure 60% confluency the next day. Cells were transfected with transfection complex in Opti-MEM (Gibco; cat. 31985062), X-treme Gene and 5 mg DNA and incubated for 24 h. Transfected cells were replated for desired assays and collected 24 or 48 h later for overexpression or knockdown assays, respectively.

BioID stable cell line generation

Stable cell lines for all 1012U iKRAS BioID lines were generated using retroviral transduction. HEK293 Phoenix cells (National Gene Vector Biorepository) were transfected with each construct using Lipofectamine 3000 (Thermo Fisher Scientific) per the manufacturer’s recommendation. Transfected cells were incubated at 37 °C for 6 h, then replenished with fresh medium and incubated at 32 °C for 72 h for viral production. The viral culture media was filtered through a 0.45-μm filter and added to 1012U iKRAS cells along with doxycycline (Dox; 1 μg/mL) and polybrene (4 μg/mL; Santa Cruz Biotechnology). At 72 h after transduction, cells were replenished with fresh media for 24 h. Puromycin (0.5 μg/mL; Thermo Fisher Scientific) was then added for 5 days to select expressing cells. Fusion protein expression and biotinylation were verified using IF and WB. Cells were grown with dox (1 mg/mL) for stable cell line maintenance. For comparative BioID analysis of −Dox and +Dox 1012U iKRAS BioID cell lines, cells were seeded without dox in biotin-free RPMI 1640 (MBS653376; MyBioSource) for 3 days and then either not induced (−Dox) or induced (+Dox, 1 mg/mL) for 3 more days prior to supplementation with 50 μM biotin for 18 h.

BioID

BioID was performed as previously described.⁴⁸ Briefly, four 10 cm dishes of cells per sample were lysed in 8 M urea 50 mM Tris pH 7.4 containing protease inhibitor (87785; Thermo Fisher Scientific) and DTT, incubated with universal nuclease (88700; Thermo Fisher Scientific), and sonicated to further shear DNA. Gelatin Sepharose 4B beads (17095601; GE Healthcare) were used to preclear samples for 2 h prior to incubation with Streptavidin Sepharose High Performance beads (17511301; GE Healthcare) for 4 h. Streptavidin beads were washed four times with 8 M urea 50 mM Tris pH 7.4 wash buffer and resuspended in 50 mM ammonium bicarbonate with 1 mM biotin.

Mass spectrometry analysis

After immunoprecipitation, proteins were digested directly on beads. Briefly, proteins bound to the beads were resuspended with 8 M urea and 50 mM ammonium bicarbonate, and cysteine disulfide bonds were reduced with 10 mM tris(2-carboxyethyl) phosphine at 30 °C for 60 min, followed by cysteine alkylation with 30 mM iodoacetamide in the dark at room temperature for 30 min. After alkylation, urea was diluted to 1 M urea using 50 mM ammonium bicarbonate, and proteins were finally subjected to overnight digestion with MS-grade trypsin/Lys-C mix (Promega). Finally, beads were pulled down and the solution with peptides collected into a new tube. The beads were then washed once with 50 mM ammonium bicarbonate to increase peptide recovery. The digested samples were desalted using a C18 TopTip (PolyLC), and the organic solvent was removed in a SpeedVac concentrator before liquid chromatography (LC)–MS/MS analysis. Dried samples were reconstituted in 100 mM ammonium formate, pH ~10, and analyzed by 2D LC-MS/MS using a 2D nanoACQUITY Ultra Performance Liquid Chromatography system (Waters, Milford, MA) coupled to a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific). Peptides were loaded onto the first-dimension column, XBridge BEH130 C18 NanoEase (300 μm 50 mm, 5 μm) equilibrated with solvent A (20 mM ammonium formate, pH 10, first-dimension pump) at 2 μL/min. The first fraction was eluted from the first-dimension column at 17% of solvent B (100% acetonitrile) for 4 min and transferred to the second-dimension Symmetry C18 trap column of 0.180 × 20 mm (Waters) using a 1:10 dilution with 99.9% second-dimension pump solvent A (0.1% formic acid in water) at 20 μL/min. Peptides were then eluted from the trap column and resolved on an analytical C18 BEH130 PicoChip column of 0.075 × 100 mm, 1.7-mm particles (NewObjective, MA), at low pH by increasing the composition of solvent B (100% acetonitrile) concentrations of solvent B. The following first-dimension fractions were eluted at 19.5, 22, 26, and 65% solvent B. The mass spectrometer was operated in positive data-dependent acquisition mode. MS1 spectra were measured with a resolution of 70,000, an AGC target of 1e6, and a mass range from 350 to 1700 m/z. Up to 12 MS2 spectra per duty cycle were triggered, fragmented by high-energy collision–induced dissociation, and acquired with a resolution of 17,500 and an automatic gain control (AGC) target of 5e4, an isolation window of 2.0 m/z, and a normalized collision energy of 25. Dynamic exclusion was enabled with duration of 20 s. All mass spectra were analyzed with MaxQuant software, v. 1.5.5.1. MS/MS spectra were searched against the Mus musculus Uniprot protein sequence database (v. July 2016) and Global Proteome Machine Common Repository of Adventitious Proteins sequences (commonly known protein contaminants). Precursor mass tolerance was set to 20 and 4.5 ppm for the first search where initial mass recalibration was completed and for the main search, respectively. Product ions were searched with a mass tolerance of 0.5 Da. The maximum precursor ion charge state used for searching was seven. Carbamidomethylation of cysteines was searched as a fixed modification, and oxidation of methionines and acetylation of protein N-terminal were searched as variable modifications. Enzyme was set to trypsin in a specific mode, and a maximum of two missed cleavages was allowed for searching. The target-decoy-based false discovery rate filter for spectrum and protein identification was set to 1%. Proteins were classified as candidate interactors if LFQ intensities were at least 3-fold greater compared to BioID2-only control.

Immunoprecipitation

Emerin immunoprecipitation was performed by resuspending 1012U cell pellet in 1 mL of lysis buffer containing 150 mM NaCl, 50 mM Tris ph 8, 0.5% NP-40, 10% glycerol, and complete protease inhibitor (11697498001; Roche) and sonicated for 3 s at 10% frequency for 5 cycles with 3 s in between each cycle. Lysate was centrifuged at 2,000 rpm at 4 °C for 5 min and supernatant was collected for immunoprecipitations. Input was collected, and pellet was used to identify Emerin lost in insoluble fraction. Seven microliters of Emerin antibody or IgG control was added to the lysate and incubated at 4 °C with gentle inversion overnight. Lysate was then incubated with magnetic beads (Dynabeads, 10009D; Invitrogen) for 1 h at room temperature. Magnetic beads were isolated using a magnetic microcentrifuge tube rack and washed three times with washing buffer containing 300 mM NaCl, 50 mM Tris pH 8, 0.5% NP-40. Protein was then mixed with 1× Laemmli buffer and heated at 95 °C for 5 min.

Proximity ligation assay (PLA)

1012U cells were seeded at 30% confluency on round 25 mm coverslips (174985; Thermo Fisher Scientific) in a six-well plate and cultured with or without doxycycline at 37 °C for 72 h. Cells were then washed 3× with 1 × PBS and fixed for 15 min with 3.2% (wt/vol) paraformaldehyde/1× phosphate-buffered saline (PBS) at room temperature, followed by permeabilization in 0.1% Triton X-100 in PBS for 10 min on ice. Coverslips were blocked with Duolink blocking buffer (DUO82007–4mL; Sigma-Aldrich) for 1 h at room temperature. PLA was performed using the Duolink In Situ Orange Starter Kit Mouse/Rabbit (DUO92102; Sigma). Primary antibodies (Emerin/Nesprin-3 or anti-HA/Nesprin-3) were incubated for 1 h at room temperature. PLA was performed according to the manufacturer’s specifications except for amplification times: 300 min for Emerin/Nesprin-3; 60 min for anti-HA/Nesprin-3. Cover slips were mounted in Duolink DAPI (DUO82040–5ML; Sigma-Aldrich). For negative controls, coverslips were incubated with a single primary antibody and both mouse and rabbit PLA secondary probes were used during processing for PLA. Microscopy was performed using a Zeiss LSM800 with Zeiss AxioObserver Z1 microscope and C-Aprochromat 63×/1.20 W objective. Z stacks were taken at 1 mm slices with a scan speed of 9, and 8-bit depth. Diode lasers used were 561 and 405 nm and detected using GaASP-PMT.

Western blot analysis

Cells were lysed in RIPA buffer (50 mM Tris-HCl pH 7.5, 1% NP-40, 150 mM NaCl, 5 mM EDTA, 0.25% NaDOC, and 1.0% SDS) with complete protease inhibitor, sonicated, and centrifuged. Lysates were collected and quantified using a BCA kit (23225; Thermo Fisher Scientific). 20–50 mg of protein were loaded into 4–15% gel (4561086; Bio-Rad) and resolved via SDS-PAGE and transferred to PVDF membranes activated in methanol (IPVH00010; Millipore). Membranes were blocked in either 5% nonfat dry milk (20–241; Apex Chemicals and Reagents) or 3% BSA (9048–46-8; RPI) in 1× PBST for 1 h. Primary antibodies were diluted in blocking buffer and incubated overnight at 4 °C. Membranes were washed three times in 1× PBST and incubated with secondary antibodies for 1 h at room temperature. Primary and secondary antibodies are reported below (Table 1). Blots were developed using SuperSignal West Pico Chemiluminescent Substrate (34080; Thermo Fisher Scientific) and imaged with BioRAD ChemiDocTM Imaging System. Images were viewed and quantified using ImageJ Fiji software v. 2.14.0.

qRT-PCR

RNA was extracted from cells using TRIzol reagent (15596018; Invitrogen). Two mg of RNA was reverse transcribed into cDNA using the High-Capacity cDNA kit (4368814; Applied Biosystems). Specific genes were amplified using the SsoAdvanced Universal SYBR Green Supermix (1725274; BioRAD), Bio-Rad CFX384 RT-PCR instruments and validated primers specific for the genes of interest. Expression primers used were: mouse Emerin (Forward- TCGTCATCTTCTTCATTCTCCTATC; Reverse-TCATTATAGTCCTTGCTCTGGTAAA), mouse Nesprin-3 (Forward- GGCCACAGAACTTCGTCTC; Reverse-GTCCCTCATTGCACTGTACTC), human Nesprin-3 (Forward- CCTGCAGAGGAAAAGCAAAC; Reverse-GTGGTCACAACGATCCACTG), mouse KLF5 (Forward- GGACTCATACGGGCGAGAAG; Reverse-TGCGGTTTAAAGGATGGCAG), human KLF5 (Forward- ACTGCGATTACCCTGGTTGC; Reverse-CAGCCTTCCCAGGTACACTT), human KRAS (Forward- CAAGAGTGCCTTGACGATACA; Reverse-GACCTGCTGTGTCGAGAATATC), mouse PRT (Forward- AAGTGTTTATTCCTCATGGACTGA; Reverse-CTCCCATCTCCTTCATGACATC), human PRT (Forward- CCTGGCGTCGTGATTAGTGAT; Reverse-AGACGTTCAGTCCTGTCCATAA), mouse TBP (Forward- GAAGTTCCCTATAAGGCTGGAAG; Reverse-AGGAGAACAATTCTGGGTTTGA), human TBP (Forward- TATAATCCCAAGCGGTTTGC; Reverse-CCCAACTTCTGTACAACTCTAGCA).

Immunocytochemistry and confocal microscopy

Cells were plated on 25 mm glass coverslips (174985; Thermo Fisher Scientific) at concentrations to reach 70% confluency the following day. Cells were fixed with 3.2% paraformaldehyde (043368.9 M; Thermo Fisher Scientific) in 1× PBS. For nuclear membrane permeabilization, cells were incubated with 0.1% Triton X-100 (T8787–50ML, Millipore) in 1× PBS on ice for 8 min. Cells were blocked with 5% BSA in 1× PBS for 1 h at room temperature. Primary antibodies (Table 1) were diluted in respective blocking buffers and incubated on cells for 1 h at room temperature. Cells were washed three times in 1× PBS for 5 min each. Cells were incubated in secondary antibodies diluted 1:1000 in blocking buffer for 1 h at room temperature. Cells were washed three times in 1× PBS for 5 min each. Coverslips were mounted using Prolong gold with DAPI (P36931; Thermo Fisher Scientific). Confocal images were taken on an Olympus LSM8000 microscope using Zeiss Zen Blue software. Z-stack images were acquired using an interval of 0.5 mm between slices. Images were analyzed and quantified using ImageJ Fiji software.

Image analysis

Line scan was performed as previously described.⁷ 1012U cells treated with doxycycline and stained with Emerin and Nesprin-3 were compared to untreated cells and used for line scan analysis. Z-stack images through the entire nucleus were taken, and the middle plane was used for line scan. A measurement line was drawn through the long axis of each nucleus to plot Emerin and Nesprin-3 localization intensity across the nuclear periphery and interior. Profile plots for each signal were constructed by normalizing the signal to a distance of 100 to account for differences in nuclear size. The percent of signal at the periphery was taken by dividing the sum of the signal within 3 mm of the nuclear edge by the signal across the entire line. Nuclear size quantification was performed in ImageJ utilizing Z-stack images. Each image was smoothed three times, and nuclear volume and surface area were calculated using 3D Object Counter using a threshold of 30 and minimum size of 50. Clustered and partial nuclei were excluded.

Human tissue analysis

Three normal pancreas, Nesprin-3 low and Nesprin-3 high IHC images were downloaded from Human Protein Atlas (www.proteinatlas.org).⁴² Nuclear size was analyzed in QuPath using Cell detection with Hematoxylin OD. The following parameters were set: Background radius: 5 px, Median filter radius: 0 px, Sigma: 3.5 px, Minimum area: 20 px², Maximum area: 150 px², Threshold: 0.03, Max background intensity: 2, Cell expansion: 5 px. Nucleus area was visualized in GraphPad Prism.

Proliferation assays

Cells were plated on 10 cm plates to reach 60% confluency the following day. The day after plating, cells were transfected with siRNA or DNA mixtures and incubated for 24 h. 1000 cells per well were then replated onto 96-well plates for CyQUANT or MTT assays. For both assays, a baseline assay was performed 6 h after replating. CyQUANT assays were performed using the CyQUANT NF Cell Proliferation Assay Kit (C35007; Invitrogen) per manufacturer’s protocol, 72 h post replating. Briefly, 5× HBSS buffer was diluted to 1× with nanopure H₂O and 1 °CyQUANT NF dye reagent was added. Existing cell culture medium was removed and 100 μL CyQUANT mixture was added to each well. The cells were incubated at 37 °C for 1 h. The plate was read using fluorescence (λ_exc = 485 nm, λ_em = 525 nm). MTT assays were performed using Thiazolyl Blue Tetrazolium Bromide (M5655–1G, Sigma-Aldrich). Briefly, 10 μL 5 mg/mL MTT was added directly to existing cell medium 72 h post replating. Cells were incubated at 37 °C for 2 h. Following incubation, the MTT-media mixture was removed and 100 μL DMSO was added and incubated at 37 °C for 15 min. The plate was read using absorbance at 540 nm. For all proliferation assays, the 72 h timepoint was normalized to the baseline reading. Protein and RNA for knockdown and overexpression validation were collected 24 h after replating.

RNA-seq

RNA-seq was performed in 1012U cells under −Dox and +Dox conditions. Total RNA was isolated using TRIzol reagent and RNeasy Mini Kit (74104; Qiagen) following treatment with doxycycline for 72 h. RNA-seq library generation and sequencing was performed by the London Regional Genomics Center at the University of Western Ontario (Canada). Processing and trimming of RNA-seq FASTq files were performed using Trim Galore 0.6.4 and cutadapt 2.10 with Python 3.6.5. FastQC was utilized to evaluate read quality, and STAR 2.7.3a was used for alignment with mm10 genome as reference using the Mayo Biocluster. FeatureCounts (Galaxy Version 1.6.4) and DESeq2 (Galaxy Version 2.11.40.6) were utilized to evaluate read counts and differential gene expression. Significantly differentially expressed genes were identified using the following metrics: base mean ≥1, log₂ fold change >1 or <−1, and an FDR of ≤0.05. Heatmaps were generated in RStudio software using pheatmap version 1.0.12. RNA-seq files from KLF5 knock-out cell lines were obtained from SRA.²⁷ DESeq2 was utilized to evaluate read counts and differential gene expression for Nesprin-3. Nesprin-3 differential gene expression was visualized in RStudio 2025.05.0 using ggplot2.⁴⁹ SP and KLF family transcription factor expression was evaluated in the non-targeted control RNA-seq samples in human cell lines.⁵⁰ Z-scores were calculated in each cell line separately across all genes and visualized in heatmaps using pheatmap version 1.0.12.

ChIP-seq analysis and visualization

ChIP-seq was performed in 1012 U cells under −Dox and +Dox conditions. Cells were –harvested and resuspended in 1× PBS at 1 × 10⁶ per ml. Next, 1.5 × 10⁶ cells were transferred to a fresh 1.5 mL Eppendorf tube for each treatment condition. Cells were pelleted at 500 × g for 6 min at 4 °C using the low- or no-brake option to prevent the pellet from being disturbed during centrifuge slow-down. Cells were lysed in 120 μL native ChIP-seq lysis buffer (0.1% Triton X-100, 0.1% Deoxycholate, 1× complete protease inhibitor) per 1.5 × 10⁶ cells. Shearing was performed by incubating samples with 2.5 U/mL of MNase (M0247S; New England Biolabs) for 10 min at 25 °C. Histone marks were immunoprecipitated with 1 mg of antibody (Table 1) per 0.5 × 10⁶ cells for each sample. Input represents 1% of total sample. Library generation and sequencing was outsourced to the University of Western Ontario. Bowtie2 was utilized to align H3K4me1, H3K4me3, and H3K27Ac ChIP-seq FASTq files to the mouse genome (mm10).⁵¹ Significant peaks were identified with MACS2 call peak and differential binding analysis was performed with DiffBind with peaks summits set to 500.^52–54 Significance was determined with an FDR of ≤ 0.05. For enhancer analysis, overlapping H3K27Ac and H3K4me1 called peaks unique to −Dox and +Dox conditions were identified with bedtools Intersect Intervals.⁵⁵ Genes unique to −Dox and +Dox enhancers, from overlapping peaks, were identified using GREAT analysis for the single nearest gene within 5–30 kb.²⁹ Kegg analysis was performed on genes identified from GREAT analysis to identify differentially expressed pathways and the associated genes.³⁰ Histone mark differential binding was validated in a selection of genes identified in Kegg analysis. Specifically, the average histone mark signal over the 5–30 kb range was Log2 normalized to the input signal of that mark⁵⁶ and visualized in a heatmap in RStudio 2025.05.0 using pheatmap version 1.0.12. KLF5 ChIP-seq BigWig files were obtained from SRA²⁷ and visualized utilizing Integrative Genome Viewer.

Statistical analysis

All statistical analyses and construction of graphs were done using GraphPad Prism 9 software. All data are comprised of at least three independent experiments. Data were checked for normality and lognormality to direct statistical test choice. For experiments with two groups, either a parametric unpaired t test, if normality was passed, or a non-parametric two-tailed Mann–Whitney U test, if normality not passed, were performed. For experiments with three or more groups that passed normality, a one-way ANOVA test and the corresponding Tukey’s multiple comparison for statistical significance were performed. If normality was not passed a Kruskal–Wallis test followed by a Dunn’s test for statistical significance were performed. P values < 0.05 were considered statistically significant.