| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse anti-human CD45-PB, Clone HI30 (1:50) | BioLegend | Cat#304029 |
| Mouse anti-human CD235a-PB, Clone HIR2 (1:50) | BioLegend, | Cat#306612 |
| Mouse anti-human CD31-biotin, Clone WM-59 (1:50) | Thermo Fisher Scientific™ | Cat#13–0319-82 |
| Mouse anti-human CD202b, biotin-linked, Clone 33.1 (1:50) | BioLegend | Cat#334204 |
| Streptavidin, APC-AF750 (1:100) | Thermo Fisher Scientific™ | Cat#SA1027 |
| Mouse anti-human CD146-PE-Cy7, Clone SHM-57 (1:50) | BioLegend | Cat#342010 |
| Mouse anti-human PDPN-APC, Clone NZ-1.3 (1:50) | Thermo Fisher Scientific™ | Cat#17–9381-42 |
| Mouse anti-human THY1-PE, Clone 5E10, (1:50) | BioLegend | Cat#328110 |
| Mouse anti-human CD164-PE, Clone X, (1:50) | BioLegend | Cat#324808 |
| Mouse anti-human CD73-FITC, Clone Ad2, (1:50) | BioLegend | Cat#344016 |
| Mouse anti-human CD2-PE-Cy5, Clone RPA-2.10, (1:50) | BD Biosciences | Cat#555328 |
| Mouse anti-human CD3-PE-Cy5, Clone HIT3a, (1:50) | BD Biosciences | Cat#555341 |
| Mouse anti-human CD4-PE-Cy5, Clone RPA-T4, (1:50) | BD Biosciences | Cat#555348 |
| Mouse anti-human CD7-PE-Cy5, Clone M-T701, (1:50) | BD Biosciences | Cat#555362 |
| Mouse anti-human CD8-PE-Cy5, Clone RPA-T8, (1:50) | BD Biosciences | Cat#555368 |
| Mouse anti-human CD11b-PE-Cy5, Clone ICRF44, (d1:50) | BD Biosciences | Cat#555389 |
| Mouse anti-human CD14-PE-Cy5, clone MϕP9, (1:50) | BD Biosciences | Cat#562692 |
| Mouse anti-human CD16-PE-Cy5, Clone 3G8, (1:50) | BD Biosciences | Cat#555408 |
| Mouse anti-human CD19-PE-Cy5, Clone HIB19, (1:50) | BD Biosciences | Cat#555414 |
| Mouse anti-human CD20-PE-Cy5, Clone 2H7, (1:50) | BD Biosciences | Cat#561761 |
| Mouse anti-human CD56-PE-Cy5, Clone B159, (1:50) | BD Biosciences | Cat#555517 |
| Mouse anti-human CD38-PE-Cy7, Clone HB7, (1:50) | BD Biosciences | Cat#33579 |
| Mouse anti-human CD90-FITC, Clone 5E10, (1:25) | BD Biosciences | Cat#555595 |
| Mouse anti-human CD123-PE, Clone 7G3, (1:10) | BD Biosciences | Cat#554529 |
| Mouse anti-human CD235a (GPA)-PE-Cy5, clone GAR2 (1:100) | BD Biosciences | Cat#559944 |
| Mouse anti-human CD34-APC-R700, Clone 8G12, (1:25) | BD Biosciences | Cat#659123 |
| Mouse anti-human CD10-APC-Cy7, Clone HI10a, (1:25) | BioLegend | Cat#312212 |
| Mouse anti-human CD45RA-BV605, Clone HI100, (1:20) | BioLegend | Cat#304133 |
| Mouse anti-human CD45R-PE/DAZZLE 594, Clone RA3–6B2, (1:100) | BioLegend | Cat#103258 |
| Mouse anti-human HLA-A,B,C FITC, Clone W6/32(1:100) | BioLegend | Cat #311404 |
| Mouse anti-human CD19-AF700, Clone HIB19, (1:100) | BioLegend | Cat#302226 |
| Mouse anti-human CD33-AF647, Clone P67.6 (1:100) | BioLegend | Cat#366626 |
| Purified rabbit anti-human CD164, (1:100) | Sigma-Aldrich | Cat#HPA010636 |
| Purified anti-Perilipin A, (1:100) | Chemicon | Cat#AB10200 |
| Purified Adiponectin, (1:100) | Invitrogen | Cat#MA1–054 |
| Purified mouse anti-Human Nuclear Antigen, [235–1] (1:100) | Abcam | Cat#ab191181 |
| Purified rabbit polyclonal Collagen II, (1:100) | Abcam | Cat#ab34712 |
| Purified mouse anti-Osteocalcin [OC4–30], (1:100) | Abcam | Cat#ab13418 |
| Secondary goat anti-rabbit-AF-488 (1:500) | Molecular Probes | Cat#A11034 |
| Secondary goat anti-rat AF488 (1:500) | Invitrogen | Cat#A11006 |
| Secondary goat anti-mouse AF647 (1:500) | Invitrogen | Cat#A21236 |
| Secondary donkey anti-rabbit AF647 (1:500) | Molecular Probes | Cat#A31573 |
| Anti-human CD45 microbeads (1:100) | Miltenyi Biotec | Cat#130–045-801 |
| Anti-human CD34 microbeads (1:100) | Miltenyi Biotec | Cat#130–056-701 |
| Bacterial and Virus Strains | ||
| Lentivirus carrying GFP, RFP, and CFP. | Subcloned in the Weissman laboratory from pLL3.7 (Rubinson et al., 2003) | Addgene#11795 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| DAPI | Biolegend | Cat#422801 |
| DiD lipophilic dye-AF647 | Life Technologies | Cat#V22887 |
| propidium iodide (PI) | Sigma-Aldrich | Cat#P4170 |
| Matrigel | Corning | Cat#CB40234A |
| paraformaldehyde (PFA) | Electron Microscopy Sciences | Cat#15710 |
| Bovine serum albumin (BSA) | Sigma-Aldrich | Cat#A9647 |
| Donkey serum | Sigma-Aldrich | Cat#D9663 |
| Goat Serum | Thermo Fisher Scientific™ | Cat#G9023 |
| Tris Buffered Saline (TBS), 10× solution | Sigma-Aldrich | Cat#T5912 |
| Phosphate Buffered Saline (PBS) | GIBCO | Cat#C14190500BT |
| Fluoromount-G | Invitrogen | Cat#00–4958-02 |
| rhBMP2 (recombinant human BMP2) | R&D Systems | Cat#355-BM/CF |
| rhVEGFR1 (recombinant human VEGFR1) | R&D Systems | Cat#321-FL/CF |
| Recombinant RNase inhibitor | Clontech | Cat#2313B |
| Triton X-100 10% | Thermo Fisher Scientific™ | Cat#85111 |
| MMLV SMARTScribe reverse transcriptase | Clontech | Cat#639538 |
| KAPA HiFi hotStart ReadyMix | Kapa Biosystems | Cat#KK2602 |
| Saffron | Sigma-Aldrich | Cat#S8381–5G |
| Acid Red 73 | Sigma-Aldrich | Cat#49823–25MG |
| Alcian Blue 8GX | Sigma-Aldrich | Cat#A3157–25G |
| Acid Fuchsin | Sigma-Aldrich | Cat#F8129–25G |
| Phosphotungstic Acid | Sigma-Aldrich | Cat#P4006 |
| Hematoxylin | Sigma-Aldrich | Cat#MHS32–1L |
| Eosin Y | Thermo Fisher Scientific™ Shandon™ | Cat#6766009 |
| Calcein-AM | Invitrogen | Cat#C1430 |
| Hoescht | Thermo Fisher Scientific™ | Cat#62249 |
| Type II collagenase | Sigma-Aldrich | Cat#C6885 |
| 100 U/mL DNase I | Worthington | Cat#NC9199796 |
| Fetal bovine serum (FBS) | Fisher Scientific | Cat#16000–069 |
| Histopaque of density 1.119 g/mL | Sigma-Aldrich | Cat#11191 |
| Alizarin Red stain | Sigma-Aldrich | Cat#A5533 |
| TRIzol LS | Invitrogen | Cat#10296028 |
| Ethylenediaminetetraacetic acid (EDTA) | Invitrogen | Cat#15573–038 |
| Optimal Cutting Temperature compound (OCT) | Fisher Scientific | Cat#23–730-571 |
| Human platelet derived lysate | Stem Cell Technologies | Cat#06960 |
| MEM alpha medium | Thermo Fisher Scientific™ | Cat#12561–056 |
| Penicillin-Streptomycin Solution | Thermo Fisher Scientific™ | Cat#15140–122 |
| 0.1% Gelatin Solution | Millipore | Cat#ES-006-B |
| Media 199 (M199) | Sigma-Aldrich | Cat#C6885 |
| Dulbecco’s Modified Eagle Medium (DMEM)/F12 | Thermo Fisher Scientific™ | Cat#11320–033 |
| Dexamethasone | MP Biomedicals | Cat#194561 |
| Sodium β-glycerophosphate | Sigma-Aldrich | Cat#G9891 |
| Ascorbic acid 2-phosphate | Sigma-Aldrich | Cat#A8960 |
| Human Insulin Recombinant Protein | Invitrogen | Cat#RP-10908 |
| 3-isobutyl-1-methylxanthine (IBMX) | Sigma-Aldrich | Cat#I7018 |
| Indomethacin | Sigma-Aldrich | Cat#57413 |
| Oil Red O | Sigma-Aldrich | Cat#O0625 |
| Alcian blue stain | Sigma-Aldrich | Cat#A5268 |
| Geltrex | Gibco | Cat#A1569601 |
| Essential 8 Medium | Gibco | Cat#A1007101 |
| Human recombinant stem cell factor | Peprotech | Cat#300–07 |
| Human recombinant thrombopoietin | Peprotech | Cat#300–18 |
| Human basic fibroblast growth factor | R&D Systems | Cat#P09038 |
| Human ng/mL insulin growth factor | R&D Systems | Cat#P05019 |
| Stemline serum-free hematopoietic stem cell expansion media | Sigma-Aldrich | Cat#S0192 |
| 2× TD Buffer (Tagmentation DNA Buffer) | Illumina | Cat#FC-121–1030 |
| Tn5 enzyme | Illumina | Cat#FC-121–1030 |
| Digitonin | Promega | Cat#G9441 |
| Agencourt AMPure XP beads | BEECKMAN COULTER | Cat#A63882 |
| UltraPure™ DNase/RNase-Free Distilled Water | Thermo Fisher Scientific™ | Cat#10977023 |
| Critical Commercial Assays | ||
| Nextera XT DNA Library Preparation kit | Illumina | Cat#FC-131–1096 |
| High Sensitivity DNA analysis kit | Advanced Analytics, Stanford SFGF facility | N/A |
| Qubit dsDNA HS Assay kits | Thermo Fisher Scientific™ | Cat#Q32851 |
| M.O.M. immunodetection kit | Vector Laboratories | Cat#BMK-2202 |
| RNeasy Micro Kit | Qiagen | Cat#74004 |
| Arcturus™ RiboAmp™ PLUS Kit | Applied Biosystems™ | Cat#KIT0521 |
| StemPro chondrogenesis differentiation kit | Thermo Fisher Scientific™ | Cat#A1007101 |
| QIAGEN MinElute Reaction Cleanup kit | QIAgen | Cat#28204 |
| Deposited Data | ||
| Microarray data, ATAC-seq data, sc-RNA-seq data | This paper | PRJNA478935 |
| Experimental Models: Cell Lines | ||
| Human: Human monocyte derived iPSC line SCVI 113 | A gift from the laboratory of Joseph C. Wu | N/A |
| Experimental Models: Organisms/Strains | ||
| Mouse: BA (C57BL/Ka-Thy1.1-CD45.1) | The Jackson Laboratory | JAX: 000406 |
| Mouse: NSG (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ) | The Jackson Laboratory | JAX: 005557 |
| Mouse: RFP (B6.Cg-Tg(CAG-mRFP1)1F1Hadj/J) | The Jackson Laboratory | JAX: 005884 |
| Human: human fetal samples | Stemexpress | N/A |
| Oligonucleotides | ||
| Oligo-dT30VN (5′– AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) | IDT | N/A |
| template-switching oligonucleotide (TSO) (5′-AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3′) | Exiqon | N/A |
| ISPCR primers (5′-AAGCAGTGGTATCAACGCAGAGT-3′) | IDT | N/A |
| dNTP | Invitrogen | Cat#10297–018 |
| ERCC (External RNA Controls Consortium) ExFold RNA Spike-In Mixes | Invitrogen | Cat#4456739 |
| Recombinant DNA | ||
| cDNA expression cassettes for SOST | Genecopeia | Cat#Mm11378 |
| cDNA expression cassettes for DNAJB6 | Genecopeia | Cat#Mm21356 |
| Software and Algorithms | ||
| Leica DMI6000B inverted microscope system running Leica Application Suite (LAS)-X software | Leica Microsystems | NA |
| ImageJ | NIH | http://wsr.imagej.net/distros/osx/ij152osx-java8.zip |
| GraphPad Prism 6.0 | GraphPad Software | https://www.graphpad.com/scientific-software/prism |
| Bioanalyzer | Agilent | https://www.genomics.agilent.com/en/Bioanalyzer-System/2100-Expert-Software/?cid=AG-PT-106&tabId=AG-PR-1002 |
| Qubit 2.0 Fluorometer runs specific Invitrogen Qubit quantitation assays | Invitrogen | REF. Q32866 |
| NextSeq 500; The NextSeq System Suite software; NCS v2.0 | Illumina | ftp://webdata2:webdata2@ussdftp.illumina.com/downloads/Software/nextseq/nextseq-system-suite-v2-0-1.zip |
| HiSeq 4000 | Illumina | ftp://webdata2:webdata2@ussd-ftp.illumina.com/downloads/software/hiseq/hiseq-3000-4000hcs-3-4-0-38.zip |
| FlowJo | FLOWJO LLC | https://www.flowjo.com/ |
| bcl2fastq2 2.18 | Illumina | https://support.illumina.com/sequencing/sequencing_software/bcl2fastqconversion-software.html |
| Skewer | Jiang et al., 2014 | https://sourceforge.net/projects/skewer |
| STAR 2.4 | Dobin et al. 2013 | https://github.com/alexdobin/STAR |
| RSEM 1.2.21 | Li and Dewey, 2011 | https://deweylab.github.io/RSEM/ |
| Gene Expression Commons (GEXC) database | Seita et al. 2012 | http://gexc.riken.jp |
| The R package for Statistical Computing | The R Foundation | https://www.rproject.org/ |
| BD FACSAria II | BD Biosciences | http://www.bdbiosciences.com/cn/home |
| Molecular Signatures Database | MSigDB | http://software.broadinstitute.org/gsea/msigdb |
| Gene Chip Scanner 3000 running GCOS 1.1.1 software | Affymetrix | http://www.affymetrix.com/products/software/specific/gcos.affx |
| CutAdapt (Martin, 2011) | Martin, 2011 | http://code.google.com/p/cutadapt/ |
| Bowtie2 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| MACS2 v. 2.0.10, pileup | Buenrostro et al 2013 | http://liulab.dfci.harvard.edu/MACS/ |
| HOMER | Heinz et al., 2010 | Homer.ucsd.edu/homer/ |
| Other | ||
| Mouse Affymetrix 430–2.0 array | Affymetrix, Applied Biosystems™ | Cat#900495 |
| Human Affymetrix HG-U133+ array | Affymetrix, Applied Biosystems™ | Cat#901569 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.