Regulation of spindle and kinetochore‐associated protein 1 by antitumor miR‐10a‐5p in renal cell carcinoma

ccRCC clinical specimens and cell culture

A total of 15 pairs of ccRCC specimens and adjacent noncancerous specimens were collected from patients who had undergone radical nephrectomy at Chiba University Hospital (Chiba, Japan) from 2012 to 2015. Clinicopathological characteristics of the patients are summarized in Table 1. Four patients who died of ccRCC after TKI treatment underwent autopsy at Teikyo University Chiba Medical Center Hospital from 2012 to 2016, as summarized in Table 2. These specimens were staged according to the General Rule for Clinical and Pathological Studies on Renal Cell Carcinoma based on the American Joint Committee on Cancer (AJCC)‐UICC TNM classification.24 Written consent for tissue donation for research purposes was obtained from each patient before tissue collection. We used two human ccRCC cell lines (786‐O and A498) obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) as previously described.22, 25, 26, 27, 28

RNA extraction

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol, as described previously.22, 25, 26, 27, 28 RNA quality was confirmed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

Quantitative real‐time reverse transcription polymerase chain reaction (qRT‐PCR)

The procedure for PCR quantification was described previously.22, 25, 26, 27, 28 Expression levels of miR‐10a‐5p (Assay ID: 000387) were analyzed by TaqMan qRT‐PCR (TaqMan MicroRNA Assay; Applied Biosystems, Foster City, CA, USA) and normalized to the expression of RNU48 (assay ID: 001006; Applied Biosystems). TaqMan probes and primers for SKA1 (P/N: Hs00536843_m1; Applied Biosystems), GAPDH (internal control; P/N: Hs02758991_m1; Applied Biosystems), and GUSB (internal control; P/N: Hs00939627_ml; Applied Biosystems) were assay‐on‐demand gene expression products.

Transfections with mature miRNA, siRNA, or plasmid vectors

The following mature miRNA species were used in this study: mature miRNA and Pre‐miR miRNA Precursor (hsa‐miR‐10a‐5p; P/N: AM17100; Applied Biosystems). The following siRNAs were used: Stealth Select RNAi siRNA, si‐SKA1 (cat. nos. HSS137392 and HSS137393; Invitrogen), and negative control miRNA/siRNA (P/N: AM17111; Applied Biosystems). SKA1 plasmid vectors were designed and provided by ORIGENE (cat. no. RC202370; Rockville, MD, USA). miRNAs and siRNAs were incubated with Opti‐MEM (Invitrogen) and Lipofectamine RNAiMax transfection reagent (Invitrogen), as previously described.22, 25, 26, 27, 28 Plasmid vectors were incubated with Opti‐MEM and Lipofectamine 3000 reagent (Invitrogen) by forward transfection following the manufacturer's protocol.

Cell proliferation, migration, and invasion assays

786‐O and A498 cells were transfected with 10 nM miRNAs or siRNAs by reverse transfection. Cell proliferation was determined by XTT assays using a Cell Proliferation Kit II (Sigma‐Aldrich, St Louis, MO, USA). Cell migration was evaluated with wound healing assays. Cell invasion was analyzed using modified Boyden chambers containing Transwell‐precoated Matrigel membrane filter inserts (cat. no. 354480; BD Biosciences, Bedford, MA, USA). These assays were carried out as described previously.22, 25, 26, 27, 28 All experiments were carried out in triplicate.

Selection of putative target genes regulated by miR‐10a‐5p in ccRCC cells

To identify miR‐10a‐5p target genes, we used in silico analyses and genome‐wide gene expression analyses, as described previously. We used the TargetScanHuman 7.1 (June, 2016 release, http://www.targetscan.org/vert_71) database, TCGA, and OncoLnc (http://www.oncolnc.org/) to select and narrow down putative miRNA target genes.29, 30 An oligo microarray (Human Ge 60K; Agilent Technologies) was used for gene expression analysis. The microarray data were deposited into the GEO database (https://www.ncbi.nlm.nih.gov/geo/; accession number: GSE93290).

Western blotting

Cells were harvested 48 h after transfection, and lysates were prepared. Immunoblotting was carried out with rabbit anti‐SKA1 antibodies (1:1,000 dilution, SAB2701430; Sigma‐Aldrich), anti‐AKT antibody (1:1000, #4691; Cell Signaling Technology, Danvers, MA, USA), anti‐p‐AKT antibody (1:1000, #4060; Cell Signaling Technology), anti‐ERK1/2 antibody (1:1000, #4695; Cell Signaling Technology), anti‐p‐ERK1/2 antibody (1:2000, #4370; Cell Signaling Technology), anti‐FAK antibody (1:1000, #3285; Cell Signaling Technology) and anti‐p‐FAK antibody (1:1000, #8556; Cell Signaling Technology), anti‐SRC antibody (1:1000, #2123; Cell Signaling Technology) and anti‐p‐SRC antibody (1:1000, #6943; Cell Signaling Technology). Anti‐glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) antibodies (1:10000, ab8245; Abcam, Cambridge, UK) were used as an internal loading control. Experimental procedures were carried out as described previously.22, 25, 26, 27, 28 Protein expression was quantified by using NIH‐ImageJ.

Plasmid construction and dual‐luciferase reporter assays

The partial wild‐type sequence of the SKA1 3′‐UTR or that with deletion of the miR‐10a‐5p target site was inserted between the XhoI‐PmeI restriction sites in the 3′‐UTR of the hRluc gene in the psiCHECK‐2 vector (C8021; Promega, Madison, WI, USA). The procedures were described previously.22, 25, 26, 27, 28

Immunohistochemistry

Tissue specimens were incubated overnight at 4°C with anti‐SKA1 antibodies (1:500 dilution, SAB2701430; Sigma‐Aldrich). The slides were treated with biotinylated goat antibodies (Histofine SAB‐PO kit; Nichirei, Tokyo, Japan). The procedures were described previously.22, 25, 26, 27, 28

TCGA database analysis of ccRCC

To explore the clinical significance of miRNAs and target genes, we used the TCGA database. Gene expression and clinical data were retrieved from cBioportal (http://www.cbioportal.org/) 31 and OncoLnc (data downloaded on April 30, 2017). We selected high and low target genes expression groups defined by the median value, and data were analyzed by Kaplan‐Meier survival curves and log‐rank statistics.

Statistical analysis

Relationships between two groups and the numerical values obtained by qRT‐PCR were analyzed using Mann‐Whitney U‐tests and paired t‐tests. Spearman's rank test was used to evaluate the correlation between the expression levels of miR‐10a‐5p and SKA1. Relationships among more than three variables and numerical values were analyzed using Bonferroni‐adjusted Mann‐Whitney U‐tests. Survival analysis was carried out using the Kaplan–Meier method and log‐rank tests with JMP software (version 13; SAS Institute Inc., Cary, NC, USA); all other analyses were carried out using Expert StatView (version 5; SAS Institute Inc.).

Expression levels of miR‐10a‐5p in ccRCC specimens and cell lines

The public miRNA database (miRbase: release 21) showed that miR‐10a‐5p was located on chromosome 17q21.32. The mature sequence of miR‐10a‐5p was found to be 5′‐UACCCUGUAGAUCCGAAUUUGUG‐3′ (Fig. 1b). We evaluated the expression of miR‐10a‐5p in clinical kidney specimens (noncancerous tissues, ccRCC tissues, and autopsy specimens of ccRCC) and cell lines. Expression levels of miR‐10a‐5p were significantly downregulated in primary cancer tissues and TKI‐treated tissues compared with those in noncancerous tissues (P = 0.0010, P = 0.0009, respectively; Fig. 2a). In 786‐O and A498 cells, expression levels of miR‐10a‐5p were relatively low compared with those of clinical specimens (Fig. 2a).

Effects of restoring miR‐10a‐5p on cell proliferation, migration, and invasion activities in ccRCC cell lines

To investigate the functional efficacy of miR‐10a‐5p, we carried out gain‐of‐function studies using miRNA transfection into 786‐O and A498 cells. XTT assays showed that cell proliferation was significantly inhibited in miR‐10a‐5p transfectants compared with that in mock or miR‐control transfectants (Figs 2b; S1a). Migration assays showed that cell migration activity was significantly inhibited in miR‐10a‐5p transfectants in comparison with those in mock or miR‐control transfectants (Figs 2c; S2a). Similarly, Matrigel invasion assays showed that cell invasion activity was significantly inhibited in miR‐10a‐5p transfectants in comparison with those in mock or miR‐control transfectants (Figs 2d; S2b).

Identification of candidate genes regulated by miR‐10a‐5p in ccRCC cells

To further elucidate the molecular mechanisms and pathways regulated by antitumor miR‐10a‐5p in ccRCC cells, we carried out a combination of in silico analyses and oligo microarray analyses using miR‐10a‐5p transfectants. The strategy for selection of miR‐10a‐5p target genes is shown in Figure 3. First, we used TargetScanHuman 7.1 database and identified that 3661 genes had putative target sites for miR‐10a‐5p in their 3′‐UTR. Next, we paired down the 3661 genes based on gene expression data (GEO database accession number: GSE93290), and 31 genes were markedly downregulated after transfection of 786‐O and A498 cells with miR‐10a‐5p (fold‐change log₂ < −2.0; Table3). Finally, we checked the expression status of these 31 genes and the clinical significance of ccRCC using the OncoLnc database (http://www.oncolnc.org/). Kaplan‐Meier survival curves showed that high expression of eight genes was associated with poor prognosis in ccRCC (Table3; Figs 4a, 5). Among these genes, we focused on SKA1, which was most downregulated by transfection of miR‐10a‐5p, and showed the most dramatic difference in OncoLnc prognostic analysis (P = 2.72E−08, Fig. 4a).

Expression of SKA1 in ccRCC clinical specimens

A total of 15 pairs of primary ccRCC specimens, adjacent noncancerous specimens, and TKI‐treatment failure autopsy specimens from 15 sites were used for the expression analysis of SKA1 by qRT‐PCR. Expression of SKA1 was significantly upregulated in primary cancer tissues compared with that in normal tissues (P = 0.0011; Fig. 4b) and was significantly higher in autopsy specimens than in primary cancer tissues (P = 0.0011; Fig. 4b). Additionally, Spearman's rank test indicated a negative correlation between the expression levels of miR‐10a‐5p and SKA1 (Fig. 4c).

Furthermore, to analyze SKA1 protein expression, immunohistochemistry was carried out with a ccRCC tissue microarray (cat. no. KD806; US Biomax, Rockville, MD, USA) and autopsy specimens after TKI treatment (Patient D, Table2). Patient characteristics for samples used in the tissue microarray are as described in http://www.biomax.us/tissue-arrays/Kidney/KD806. SKA1 was strongly expressed in primary ccRCC tissues and autopsy specimens after TKI treatment compared with that in normal kidney (Fig.6).

SKA1 was directly regulated by miR‐10a‐5p transfection in ccRCC cells

We carried out qRT‐PCR and western blotting to validate whether restoration of miR‐10a‐5p in 786‐O and A498 cells reduced the expression of SKA1. Expression of SKA1 mRNA was significantly suppressed by miR‐10a‐5p transfection compared with that in mock‐ or miR‐control‐transfected cells (Fig. 7a). Similarly, SKA1 protein expression was repressed in the miR‐10a‐5p transfectants (Fig. 7b).

Next, we carried out luciferase reporter assays to determine whether SKA1 mRNA had a functional target site. The TargetScan database predicted that miR‐10a‐5p bound at position 28–35 in the 3′‐UTR of SKA1. We used vectors encoding a partial wild‐type sequence of the 3′‐UTR of SKA1 mRNA, including the predicted miR‐10a‐5p target site, or a vector lacking the miR‐10a‐5p target site. Luminescence intensity was significantly reduced by cotransfection with miR‐10a‐5p and the vector carrying the wild‐type 3′‐UTR of SKA1. However, luminescence intensity was not suppressed when the target site of miR‐10a‐5p was deleted from the vectors (Fig. 7c).

Effects of silencing SKA1 in ccRCC cell lines

To examine the functional significance of SKA1, we carried out loss‐of‐function studies using si‐SKA1 transfectants. First, we evaluated the knockdown efficiency of si‐SKA1 transfection in 786‐O and A498 cells. In this study, we used two types of si‐SKA1 (si‐SKA1‐1 and si‐SKA1‐2). qRT‐PCR and western blotting analyses showed that transfection with both siRNAs effectively downregulated SKA1 mRNA and SKA1 protein expression in 786‐O and A498 cells (Fig. 8a,b). Furthermore, functional assays indicated that si‐SKA1 transfection markedly inhibited cell proliferation, migration, and invasion in comparison with mock‐ or si‐control‐transfected cells (Figs 8c; S1b, S3a, S4a).

Effects of cotransfection of SKA1/miR‐10a‐5p in 786‐O cells

To validate whether the molecular pathway of SKA1/miR‐10a‐5p was critical for the progression of ccRCC, we carried out SKA1 rescue experiments by cotransfection with SKA1 and miR‐10a‐5p in 786‐O cells. SKA1 protein expression by Western blotting analysis is shown in Figure 9a. Functional assays showed that the migration and invasion abilities of ccRCC cells were recovered by SKA1 and miR‐10a‐5p transfection compared with cells with restored miR‐10a‐5p only (Figs 9b–d; S1c, S5a,b). These results supported that SKA1 affected the aggressiveness of ccRCC cells.

Clinical significance of SKA1 in ccRCC

To explore the clinical significance of SKA1 in ccRCC, we analyzed Kaplan‐Meier curves of DFS rates according to the expression level of SKA1, and the relationships among SKA1 expression and cancer stage, tumor stage, and histological grade in ccRCC were evaluated using the TCGA‐KIRC database. Kaplan‐Meier curves for DFS rates showed that the DFS of the high SKA1 expression group was significantly shorter than that of the low expression group in ccRCC (P < 0.0001, Fig. 10a). Additionally, expression levels of SKA1 were significantly increased in cases of advanced disease stage, advanced T stage, and advanced histological grade (Fig. 10b–d). These analyses suggested that SKA1 affected disease progression and malignancy in ccRCC. Similarly, TCGA data analysis results of clinical significance for the other seven genes are shown in Figures S6–S9.

Effects of SKA1 downstream signaling by si‐SKA1 knockdown or miR‐10a‐5p restoration in RCC cells

We investigated the downstream signals of miR‐10a‐5p/SKA1 axis in 786‐O cells using mature miR‐10a‐5p or si‐SKA1 transfectants. To explore the downstream survival pathways of miR‐10a‐5p/SKA1 axis, phosphorylation of ERK1/2 (Thr 202/Tyr 204), AKT (Ser 473), FAK (Tyr 397) and SRC (Tyr 416) was examined. Knockdown of SKA1 or restoration of miR‐10a‐5p markedly reduced the phosphorylation of ERK1/2, AKT, FAK and SRC (Fig. 11).