Table 1. miRNAs most increased by CS exposure in both mouse cMPs and human EMPs.
| Probeset ID | Fold CS/AC (EMP) | Fold CS/AC (cMP) | Meta analysis p-value (CS/AC) | FDR (RM-ANOVA) | Sequence | Putative function |
|---|---|---|---|---|---|---|
| let-7d_st | 2.14 | 1.6 | 8.9E-03 | 9.8E-01 | AGAGGUAGUAGGUUGCAUAGUU | Allergic airway inflammation/ asthma56; lung fibroblast EMT57; cell cycle arrest, apoptosis58 |
| miR-126_st | 1.11 | 3.74 | 2.0E-05 | 3.5E-03 | UCGUACCGUGAGUAAUAAUGCG | Angiogenesis, endothelial activation59,60; VSM turnover61,62; EPC proliferation/differentiation63 |
| miR-125a-5p_st | 1.46 | 2.42 | 5.5E-03 | 1.9E-01 | UCCCUGAGACCCUUUAACCUGUGA | Angiogenesis64; NSCLC progression 65; macrophage differentiation66 |
| miR-26a_st | 1.15 | 1.96 | 1.1E-07 | 4.7E-05 | UUCAAGUAAUCCAGGAUAGGCU | NSCLC progression, metastasis67 |
| miR-99a_st | 1.10 | 2.01 | 4.6E-05 | 7.2E-03 | AACCCGUAGAUCCGAUCUUGUG | Inhibition of cancer cell invasiveness and proliferation68 |
| let-7c_st | 1.60 | 1.34 | 1.1E-6 | 3.3E-04 | UGAGGUAGUAGGUUGUAUGGUU | Inhibition of migration, proliferation, and invasion of NSCLC69 |
| miR-33b-star_st | 1.27 | 1.59 | 3.7E-03 | 1.5E-01 | CAGUGCCUCGGCAGUGCAGCCC | Lipid metabolism70 |
| let-7a_st | 1.19 | 1.56 | 5.6E-07 | 1.9E-04 | UGAGGUAGUAGGUUGUAUAGUU | Inhibition of cancer cell proliferation71 |
| miR-22_st | 1.35 | 1.35 | 6.5E-08 | 3.8E-05 | AAGCUGCCAGUUGAAGAACUGU | Inhibition of cancer cell proliferation72; apoptosis73 |
Candidates identified by meta analysis (p < 0.01). Abbreviations: EPC: endothelial progenitor cells; NSCLC: non-small cell lung cancer.