FIG. 1.
EBNA-2-dependent transactivation of the HERV-K18 superantigen. (A) LCL transformed by deletion mutant EBV (Mg68 and 253.30) or B95-8 EBV were tested for the ability to stimulate TCRBV13 and TCRBV8 T-cell hybridomas. EBV− BL-41 lymphoma cells were also tested and compared with BL-41 infected with B95-8 (BL-41/B95-8) or EBNA-2-deficient P3HR1 virus (BL-41/P3HR1). EBV cell lines used as superantigen-presenting cells were treated overnight with phorbol myristate acetate (10 ng/ml; Calbiochem) at 37°C. Cells were washed extensively in phosphate-buffered saline, counted, and resuspended with T-cell hybrids in 96-well round-bottom plates with 105 antigen-presenting cells and 2 × 104 T-cell hybrids per well. After 24 to 48 h at 37°C, the plates were frozen at −80°C to lyse the cells, and thawed supernatants were tested for the presence of IL-2 by HT-2 bioassay as previously described (53). As the positive control, the T-cell hybrids were cross-linked with plate-bound anti-CD3 (145 2C11). The mean IL-2 production for each T-cell hybrid measured in quadruplicate wells was expressed in picograms per milliliter of culture supernatant by comparison with values from a standard curve derived from recombinant IL-2 (R & D Systems). Error bars represent the difference measured between quadruplicate wells within a single experiment. Experiments were performed at least five times. (B) Semiquantitative RT-PCR for HERV-K18 read-through transcripts and 18S rRNA was performed on uninfected BL-41, BL-41/B95-8, BL-41/P3HR1, and BL-41/P3HR1 stably transfected with EBNA-2 (MCB1-9 cells). In addition, LCL transformed by recombinant EBV with estrogen-responsive EBNA-2 (EREB/2-6 cells) were tested in the presence or absence of estrogen. cDNA was prepared by random priming of total RNA that had been DNase I treated to remove contamination by genomic DNA. All samples were prepared in the presence (+) or absence (−) of RT. The PCR sense primer was 5′ TCCGAAGAGACAGTGACATCGA 3′, directed against a HERV-K18 env-specific sequence; the antisense primer was 5′ TGGCAATGCTGGCTATGTAAGT 3′, directed against a chromosome 1q23.1-q24.1 (GenBank accession number AL121985) sequence, located 127 bp downstream of the 3′ viral long terminal repeat. PCR was performed in the presence of [32P]α-dCTP, incorporating primers specific for 18S rRNA as an endogenous standard. Since the HERV-K18 read-through transcripts were extremely rare compared with the 18S rRNA, 18S Classic competimers (Ambion) were added at a primer-to-competimer ratio of 1:20. PCR was performed by using a hot start of 4 min at 94°C and then 25 cycles of 30 s at 94°C, 90 s at 72°C, and 60 s at 55°C, followed by a 7-min extension at 72°C, which yielded products within a linear range. PCR products were separated on a 6% denaturing polyacrylamide gel. HERV-K18 read-through transcripts were quantified by phosphorimaging (Molecular Dynamics), and induction (fold) was calculated after normalization against the 18S rRNA product; values are reported below each lane.