IDH1 Regulates Phospholipid Metabolism in Developing Astrocytes

Isolation of Mouse Embryonic Astrocytes

Astrocyte enriched glial fractions were isolated from embryonic day (E) 15.5, E18.5 and adult (3 month old) Balb/c mouse brains as described previously [21]. Brains obtained from 3 month old mice were first minced and digested with papain. Isolated cells were grown in Astrocyte Medium (ScienCell) and cultured up to 7-10 days. The presence of astrocytes was confirmed by the expression of glial fibrillary acidic protein (GFAP) determined by confocal microscopy (Supplementary Figure 1) and real-time quantitative PCR (data not shown). GFAP positive cells comprised >80% of the cell population.

Immunoblotting

Cells and tissue were lysed in lysis buffer (50mM Tris-HCl pH 7.5, 150mM NaCl, 1% Igepal, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate and protease inhibitors). Total protein was quantified using the BCA Protein Assay Kit (Pierce). Equal amounts of protein were resolved by SDS-PAGE and immunoblotted using either anti-IDH1 (Santa Cruz Biotechnology), anti-IDH2 (Abcam) or anti-GAPDH (glyceraldehydes-3-phosphate dehydrogenase) (Cell Signaling) antibodies followed by horseradish peroxidise (HRP)-conjugated secondary antibodies (BioRad). Proteins were visualized by enhanced chemiluminescence.

Real Time Quantitative PCR

Total RNA was extracted using TRIzol-chloroform (Life Technologies) and purified using the RNeasy Kit (Qiagen). RNA (2μg) was transcribed to cDNA (Applied Biosystems) and real-time quantitative PCR was performed using the Applied Biosystems StepOnePlus Real-Time PCR System. The following primer sequences were used for Idh1: 5′AGGTTCTGTGGTGGAGATGC3′ and 5′TCTGCAGCATCTTTGGTGAC3′, Idh2: 5′GGCTGTCAAGTGTGCCACAATC3′ and 5′TTGGCTCTCTGAAGACGGTTCC3′.

Silencing of IDH1 Expression and Thin-Layer Chromatography of Lipids

The expression of IDH1 was knocked-down in astrocytes by electroporation of the cells with 100nM siRNA (OriGene) using the Neon Transfection System (100μl Tip, Life Technologies) with the following settings: voltage 1425, pulse width 30 and pulse number 1. After 48 h, the cells were incubated with either [9, 10-³H]-palmitic acid (2μCi/ml), [³H]-serine (5μCi/ml) or [1, 2-¹⁴C]-ethanolamine hydrochloride (0.2μCi/ml) for various times at 37°C. The cells were washed with phosphate buffered saline (PBS), trypsinized and centrifuged. Cell pellets were resuspended in 1.5 ml methanol:chloroform (2:1) and incubated at room temperature for 20 min. Chloroform (0.5ml) was subsequently added followed by 1M NaCl (0.5ml). The mixture was centrifuged at 1000 x g for 5 min and the lower lipid phase removed. All radiochemicals were purchased from Moravek Biochemicals. The lipid extracts were resolved by thin layer chromatography (TLC) using Silica Gel H plates (250μm, Analtech). The plates were first washed with chloroform:methanol (2:1) and activated by heating for 1 h at 100°C. The lipid extracts were spotted on the plates and separated in developing solvent consisting of chloroform:methanol:2-propanol:0.25% KCl:triethylamine (30:9:25:6:18). Phospholipid classes were visualized under UV light after spraying with 0.1% 8-anilino-1-naphthalene sulfonic acid and identified by comparison to authenticated standards (Avanti). Bands corresponding to sphingomyelin, PC, PS, phosphatidylinositol (PI) and PE were scraped from the plates and the amount of radioactivity incorporated was determined by scintillation counting.

Statistical Analysis

The data was analyzed using the Student’s t-test or a one-way analysis of variance followed by Tukey’s HSD test. Statistical significance was defined as p < 0.05.

IDH1 Expression and Tissue Distribution

The expression of IDH1 was examined during embryonic development and in adulthood. In the brain, the expression of IDH1 was maximal during the embryonic period and then declined in adulthood (Figure 1A and B) [22]. The expression of IDH1 appeared to be highest between E13.5-E18.5 and then declined at 2 months of age (Figure 1A and B). IDH1 expression within astrocytes isolated from E15.5 and E18.5 embryonic brains and postnatal day 2 brains also showed higher expression of IDH1 compared to astrocytes isolated from adult (3 month old) mouse brains and whole adult brain tissue (Figure 2). IDH2, the mitochondrial NADP⁺ dependent isocitrate dehydrogenase also shown to be mutated in a subset of gliomas [5] showed the same expression pattern as IDH1 (Figures 1 and 2).

In adult mice, high levels of IDH1 were present in the liver, adipose tissue and mammary gland, tissues that exhibit high levels of lipid biosynthesis (Supplementary Figure 2). Similar results were observed in rat and human tissues (data not shown). In contrast to IDH1, high levels of IDH2 were noted in the heart and skeletal muscle (Supplementary Figure 3).

IDH1 Regulates Phospholipid Metabolism in Embryonic Astrocytes

To determine whether IDH1 activity participates in the metabolism of phospholipids in developing astrocytes, we examined phospholipid synthesis in embryonic astrocytes where the expression of IDH1 was reduced using siRNA. Astrocytes were isolated from wild-type E18.5 mouse cortices and transfected with IDH1 siRNA for 48 h. Under our experimental conditions, IDH1 protein expression was reduced by approximately 70% (Figure 3A). Following the reduction of IDH1 expression, the cells were incubated with [³H]-palmitic acid, a 16-carbon saturated fatty acid, for various times and the incorporation of [³H]-palmitate into cellular phospholipids was evaluated by TLC and scintillation counting.

When lipids were extracted from E18.5 astrocytes and separated by TLC, the most abundant phospholipid was PC (data not shown). Likewise, when astrocytes were incubated with [³H]-palmitate for 6 h, the majority (50-75%) of the radioactivity taken up by astrocytes was incorporated into PCs. Less (10-30%) [³H]-palmitate was incorporated into sphingomyelin and PEs while <10% was incorporated into PS and phosphatidylinositol (PI) (Figure 3B). Upon knock-down of IDH1 expression, the incorporation of [³H]-palmitate into PCs was increased by 15-20% (p < 0.05) (Figure 3B). In contrast, the incorporation of [³H]-palmitate into sphingomyelin and PEs was decreased in cells in which IDH1 expression was knocked-down (p < 0.05) (Figure 3B). When astrocytes were incubated with [³H]-palmitate for 3 h, the incorporation of radioactivity into the phospholipid classes was similar to that seen following 6 h of incubation (data not shown). At longer incubations (>6 h) there appeared to be a redistribution of [³H]-palmitate between the PCs and PEs. To examine the redistribution of [³H]-palmitate and to determine whether the changes in PCs and PEs were due to either changes in synthesis or degradation, we performed pulse-chase experiments in which astrocytes were first incubated with [³H]-palmitate for 3 h at 37° C. The cells were then washed and incubated in regular (non-radioactive) growth medium. At various times thereafter, lipids were extracted from the cells and analyzed by TLC. Following the removal of radioactive medium, [³H]-palmitate incorporated into PCs gradually declined from 68% to 51% after 36 h while the incorporation of [³H]-palmitate into PEs increased from 11% to 29% (Figure 3C). In astrocytes where the expression of IDH1 was knocked down by siRNA, the degradation of PCs was impaired compared to control cells (Figure 3D). When the PEs were examined, the incorporation of [³H]-palmitate into PEs was decreased in cells where IDH1 expression was knocked-down (Figure 3E).

In mammalian cells, the two known routes of PE synthesis are via the decarboxylation of PS and by the CDP-ethanolamine pathway [23]. To determine whether IDH1 regulates PE synthesis via the decarboxylation of PS or through the CDP-ethanolamine pathway, astrocytes were incubated with either [³H]-serine or [¹⁴C]-ethanolamine respectively for 6 h at 37°C. When cells were incubated with [³H]-serine, the incorporation of radioactivity into the various phospholipid classes was not statistically different between the control and IDH1 knock-down cells (Figure 4A). When cells were incubated with [¹⁴C]-ethanolamine, the incorporation of [¹⁴C]-ethanolamine into PEs was significantly higher in cells where IDH1 expression was knocked-down compared to control cells (p < 0.05) (Figure 4B). Similar results were obtained when cells were incubated with [¹⁴C]-ethanolamine for either 3 h or 12 h. These observations suggest that when IDH1 activity is reduced, flux through the CDP-ethanolamine pathway increases.

Conclusions

We have identified the phospholipids as a class of lipids modulated by IDH1 in developing astrocytes. The robust expression of IDH1 during embryonic development and the postnatal period might be necessary for the optimal synthesis of lipids that would be required to support the growth of the brain.