Abstract
Intervertebral disc degeneration is the leading cause of chronic back pain. Recent studies show that raised level of SDC4, a cell-surface heparan sulfate (HS) proteoglycan, plays a role in pathogenesis of disc degeneration. However, in nucleus pulposus (NP) cells of the healthy intervertebral disc, the mechanisms that control expression of SDC4 and its physiological function are unknown. Hypoxia induced SDC4 mRNA and protein expression by ∼2.4- and 4.4-fold (P<0.05), respectively, in NP cells. While the activity of the SDC4 promoter containing hypoxia response element (HRE) was induced 2-fold (P<0.05), the HRE mutation decreased the activity by 40% in hypoxia. Transfections with plasmids coding prolyl-4-hydroxylase domain protein 2 (PHD2) and ShPHD2 show that hypoxic expression of SDC4 mRNA and protein is regulated by PHD2 through controlling hypoxia-inducible factor 1α (HIF-1α) levels. Although overexpression of HIF-1α significantly increased SDC4 protein levels, stable suppression of HIF-1α and HIF-1β decreased SDC4 expression by 50% in human NP cells. Finally, suppression of SDC4 expression, as well as HS function, resulted in an ∼2-fold increase in sex-determining region Y (SRY)-box 9 (Sox9) mRNA, and protein (P<0.05) and simultaneous increase in Sox9 transcriptional activity and target gene expression. Taken together, our findings suggest that in healthy discs, SDC4, through its HS side chains, contributes to maintenance of the hypoxic tissue niche by controlling baseline expression of Sox9.—Fujita, N., Hirose, Y., Tran, C. M., Chiba, K., Miyamoto, T., Toyama, Y., Shapiro, I. M., Risbud, M. V. HIF-1-PHD2 axis controls expression of syndecan 4 in nucleus pulposus cells.
Keywords: cartilage, hypoxia, intervertebral disc
The intervertebral disc is a complex tissue that permits a range of motions between adjacent vertebrae and accommodates high biomechanical forces. The blood vessels originating in the vertebral body penetrate the superficial region of the endplates; none of these vessels infiltrate the central aggrecan (Agc1)-rich gel-like tissue, the nucleus pulposus (NP). With respect to the annulus, this tissue is avascular except for small discrete capillary beds in the dorsal and ventral surfaces—in no case does the annulus vasculature enter the NP (1–4). Thus, the hypoxic NP is completely devoid of vasculature and expresses transcription factors hypoxia-inducible factor 1 and 2 (HIF-1 and HIF-2) that are composed of a constitutively expressed β subunit and regulatory α subunit (5). Previous work has shown that these proteins play an important role in regulating energy metabolism and synthesis of extracellular matrix components, as well as proteins that contribute to cell survival in the disc (6–11). Moreover, recent work from our laboratory has shown that degradation and transcriptional activity of HIF-α in cultured NP cells is differentially regulated by prolyl 4-hydroxylase domain (PHD) proteins, members of the 2-oxoglutarate/Fe2+-dependent dioxygenase superfamily (12, 13). While PHD2 contributes to a limited oxygen-dependent degradation of HIF-1α but not that of HIF-2α, PHD3 serves as a transcriptional cofactor of HIF-1α under hypoxia. Notably, growing evidence suggests that HIF-1α and HIF-2α are not functionally redundant in the NP (13) and that the relative importance of each of the homologues, in response to hypoxia, varies among different cell types (14).
The syndecans (SDCs) are a family of single-pass transmembrane proteins with 3–5 sites for post-translational glycosylation with predominantly heparan sulfate (HS) chains (15). These glycosaminoglycans confer them with the ability to interact with diverse extracellular ligands, including growth factors, such as FGF-2, Ihh, Wnt, and BMP-2, and matrix components like fibronectin and CCN2 (15–17). All syndecans have a short cytoplasmic region containing sites for phosphorylation and interaction with signaling and protein-scaffolding molecules (15). We previously reported that in the NP inflammatory cytokines, TNF-α and IL-1β regulate expression of SDC4 through NF-κB signaling (18). Our studies showed that p65/RelA interacts with a conserved κB element located at −97/−88 bp in SDC4 promoter in NP cells, resulting in increased gene expression, an observation also confirmed in endothelium-like cells very recently (19). Notably, our work showed that SDC4, through its HS chains, promotes Agc1 degradation by enhancing post-translational processing of a disintegrin-like and metalloprotease with thrombospondin type I motifs 5 (ADAMTS-5) protein, likely playing a key role in pathogenesis of disc disease (18). Likewise, SDC4 has been shown to play a role in articular cartilage degeneration during osteoarthritis (20). Interestingly, the prominent expression of SDC4 in healthy NP indicated that it might also play an important physiological function.
The major objective of the study was to determine whether SDC4 expression is dependent on oxemic tension and whether regulation is HIF dependent in cells of the NP. We show for the first time that in NP cells, SDC4 expression is induced by hypoxia and selectively regulated by the HIF-1–PHD2 system. Moreover, our data show that SDC4 controls expression of important transcription factor sex-determining region Y (SRY)-box 9 (Sox9) and its downstream target gene Agc1. Our findings indicate that SDC4 is important in homeostatic maintenance of hypoxic discs and that dysregulated expression may be deleterious to tissue function.
MATERIALS AND METHODS
Plasmids and reagents
psPAX2 (catalog no. 12260) and pMD2G (12259), developed by Dr. Didier Trono (École Polytechnique, Lausanne, Switzerland); HIF-1α with a double mutation (P402A/P564A; 18955), developed by Dr. William G. Kaelin (Dana Farber Cancer Institute, Boston, MA, USA); and phosphoglycerate kinase 1 (Pgk1)-3xHRE-Luc containing 3 hypoxia response elements (HREs; TGTCACGTCCTGCACGACTCTAGT) from the Pgk1 promoter upstream of firefly luciferase (26731) were obtained from Addgene (Addgene, Cambridge, MA, USA). Human SDC4 promoter constructs, wild type and with mutation in NF-κB site, were provided by Dr. Jitendra Gautam (University of Virginia, Charlottesville, VA, USA; ref. 21). 4xA1-pAgc-Luc reporter containing 4 repeats of 359-bp enhancer, which contains Sox9 binding site (found 9.477 kb upstream of the Agc1 transcription start site) with −596 to +90 bp Agc1 promoter-driving luciferase, was provided by Dr. Veronique Lefebvre (Cleveland Clinic, Cleveland, OH, USA; ref. 22). Lentiviral vectors coexpressing EGFP and ShRNA targeting rat SDC4 or control ShRNA were purchased from Genecoepia (Rockville, MD, USA). The plasmid expressing constitutively active HIF-2α (CA-HIF-2α) with a triple mutation (P405A/P530A/N851A) was provided by Dr. Celeste Simon (University of Pennsylvania, Philadelphia, PA, USA). Plasmids were kindly provided by Dr. Andree Yeramian (University of Lleida, Lleida, Spain; lentiviral ShHIF-1α coexpressing YFP; ref. 23), Mark B. Taubman (University of Rochester, Rochester, NY, USA; NF-κB-responsive luciferase reporter: 3xNF-κB-Luc; ref. 24), Kenneth Thirstrup (H. Lundbeck A/S, Valby, Denmark; lentiviral ShPHD2-coexpressing GFP; ref. 25), Karen Westerman (Harvard Medical School, Boston, MA, USA; lentiviral CA-HIF-1α vector, GFP control vector, and TAT expression plasmid), and John Basile (University of Maryland, College Park, MD, USA; lentiviral ShHIF-1β construct and control vector). As an internal transfection control, vector pRL-TK (Promega, Madison, WI, USA) containing Renilla reniformis luciferase gene was used. The amount of transfected plasmid, the pretransfection period after seeding, and the posttransfection period before harvesting, have been optimized for rat NP cells using pSV β-galactosidase plasmid (Promega; ref. 7). Surfen was obtained from the Developmental Therapeutics Program of the National Cancer Institute (U.S. National Institutes of Health, Bethesda, MD, USA).
Tissue expression analysis
Microarray expression analysis of rat tissues has been performed and reported previously (26). Briefly, following hybridization, signals were measured and processed into primary expression ratios (ratio of cyanine 5 intensity of each sample to cyanine 3 intensity of the rat common reference RNA). Normalization was performed for the median of ratios by multiplying normalization factors calculated for each feature on a microarray by the GenePix Pro 3.0 software (Molecular Devices Corp., Sunnyvale, CA, USA). The expression ratios were then converted into log2 values and reported. For the current study, these available data were analyzed for expression of SDC1-4 in bone, bone marrow, blood, tendon, annulus fibrosus (AF), NP, cartilage, fat, skin, muscle, spinal cord, brain, and lens.
Isolation of NP cells, treatments, and hypoxic culture
Rat and human NP cells were isolated using a method reported earlier (7). Human NP cells were isolated from MRI-graded tissue samples (grade 2) obtained during spinal surgery following guidelines of the U.S. Office of Human Research Institutional Review Board. Cells were maintained in DMEM and 10% FBS supplemented with antibiotics. In some experiments, cells were treated with 0.5 or 1 mM dimethyloxalylglycine (DMOG) for 5 min to 24 h. DMOG is a cell-permeable, competitive inhibitor of PHD function and results in stabilization of HIF-1α in NP cells (12). Cells were cultured in a Hypoxia Work Station (Invivo2 300; Ruskinn Technology, Bridgend, UK) with a mixture of 1% O2, 5% CO2, and 94% N2 for 4–24 h.
Real-time RT-PCR analysis
Total RNA was extracted from rat and human NP cells using RNeasy minicolumns (Qiagen, Valencia, CA, USA). Before elution from the column, RNA was treated with RNase-free DNase I (Qiagen). The purified, DNA-free RNA was converted to cDNA using EcoDry Premix (Clontech, Mountain View, CA, USA). Reactions were set up in triplicate in 96-well plates using 1 μl cDNA with SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA), to which gene-specific forward and reverse PCR primers (synthesized by Integrated DNA Technologies, Coralville, IA, USA) were added (Supplemental Table S1). PCR reactions were performed in a StepOnePlus real-time PCR system (Applied Biosystems), according to the manufacturer's instructions. β-Actin was used to normalize. Melting curves were analyzed to verify the specificity of the RT-PCR reaction and the absence of primer dimer formation.
Immunohistochemistry and fluorescence microscopy
Rat spinal tissues were fixed in 4% paraformaldehyde in PBS and then embedded in paraffin. Transverse and coronal sections, 6–8 μm in thickness, were cut. For localizing SDC4, deparaffinized sections were incubated with the anti-SDC4 antibody (Abcam, Cambridge, MA, USA) in 2% BSA in PBS at a dilution of 1:200 at 4°C overnight. After thoroughly washing the sections, the bound primary antibody was incubated with Alexa Fluor-488 conjugated anti-rabbit secondary antibody (Invitrogen, Carlsbad, CA, USA), at a dilution of 1:200 for 45 min at room temperature. Sections were visualized using a fluorescence microscope (Nikon, Japan). To assess lentiviral transduction, GFP- or YFP-positive cells were imaged using a laser-scanning confocal microscope (Olympus Fluoview; Olympus, Tokyo, Japan).
Protein extraction and Western blot analysis
Cells were placed on ice immediately and washed with ice-cold HBSS. Total cell protein was extracted using mammalian protein extraction reagent (MPER; Pierce, Rockford, IL, USA). All of the wash buffers and extraction buffer included 1× protease inhibitor cocktail (Roche, Indianapolis, IN, USA), NaF (5 mM) and Na3VO4 (200 μM). Proteins were resolved on 8–12% SDS-polyacrylamide gels and transferred by electroblotting to PVDF membranes (Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% nonfat dry milk in TBST (50 mM Tris, pH 7.6; 150 mM NaCl; and 0.1% Tween 20) and incubated overnight at 4°C in 3% nonfat dry milk in TBST with both rat and human reactive HIF-1α (1:1000; R&D Systems, Minneapolis, MN, USA), HIF-1β (1:1000; BD Biosciences, San Jose, CA, USA), PHD2 (1:1000; Cell Signaling Technology, Boston, MA, USA), SDC4 (1:1000), Sox9 (1:500; Abcam) and β-tubulin (1:3000; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) antibodies. Immunolabeling was detected using the ECL reagent (Amersham Biosciences, Piscataway, NJ, USA). Relative expression levels were determined by quantitative densitometric analysis using 1D image analysis software (Quantity One; Bio-Rad).
Site-directed mutagenesis
SDC4 wild-type reporter plasmid was used to mutate HRE sites (AGGCGTGA to AGGAAAAA). Mutants were generated using the QuickChange II XL site-directed mutagenesis kit (Stratagene, Cedar Creek, TX, USA), using forward and reverse primer pairs containing the desired mutation, following the manufacturer's instructions. The mutations were verified by sequencing using the Applied Biosystems 3730 DNA sequencer.
Transfections and dual-luciferase assay
All transient transfections were performed using only rat NP cells. NP cells were transferred to 48-well plates at a density of 2 × 104 cells/well 1 d before transfection. Lipofectamine 2000 (Invitrogen) was used as a transfection reagent. For each transfection, plasmids were premixed with the transfection reagent. The next day, the cells were harvested, and a dual-luciferase reporter assay system (Promega) was used for sequential measurements of firefly and Renilla luciferase activities. Quantification of luciferase activities and calculation of relative ratios were carried out using a luminometer (TD-20/20; Turner Designs, Sunnyvale, CA, USA).
Lentiviral production and transduction
HEK 293T cells were seeded in 10-cm plates (6×106 cells/plate) in DMEM with 10% heat-inactivated FBS 1 d before transfection. Cells were transfected with 9 μg of ShHIF-1α, ShPHD2, and ShSDC4 plasmids along with 6 μg psPAX2 and 3 μg pMD2G using Lipofectamine 2000. CA-HIF-1α and shHIF-1β were used following an earlier reported method (27, 28). After 16 h, transfection media were removed and replaced with DMEM with 5% heat-inactivated FBS and penicillin-streptomycin. Lentiviral particles were harvested at 48 and 60 h post-transfection. Rat or human NP cells were plated in DMEM with 5% heat-inactivated FBS 1 day before transduction. Cells in 10-cm plates were transduced with 5 ml of conditioned media containing viral particles along with 6 μg/ml polybrene. After 24 h, conditioned medium was removed and replaced with DMEM with 5% heat-inactivated FBS. Cells were harvested for protein extraction 5 d after viral transduction. A transduction efficiency of ∼80% was achieved, as determined from the number of GFP/YFP-positive cells.
Statistical and bioinformatic analysis
All measurements were performed in triplicate; data are presented as means ± se. Differences between groups were analyzed by the Student's t test and 1-way ANOVA. Values of P < 0.05 were considered significant. Analysis of 2.7 kb of SDC4 promoter from various vertebrate species was performed using the Evolutionary Conserved Regions (ECR) genome browser (http://ecrbrowser.dcode.org/) and the Jaspar core database (http://jaspardev.genereg.net/).
RESULTS
We have previously performed microarray analysis of 13 rat tissues, including NP and AF (26). In this study, we focused on SDC4, which is highly expressed and enriched among other isoforms in NP compared to other tissues (Fig. 1A, B). Immunohistological studies confirmed robust expression of SDC4 in the rat NP tissue compared to surrounding endplate and hypertrophic chondrocytes (Fig. 1C). To examine the relationship of SDC4 to oxemic status of NP cells, we measured expression under hypoxic condition by real-time RT-PCR and Western blot analysis. Figure 1D shows that SDC4 mRNA expression is significantly up-regulated at 8 and 24 h in hypoxia. Western blot and subsequent densitometric analysis confirmed that the protein expression is also significantly induced by hypoxia (Fig. 1E, F).
Figure 1.
Hypoxic regulation of SDC4 expression in NP cells. A) Analysis of previously reported microarray data set for SDC1-4 expression in 13 rat tissues: bone, bone marrow, blood, tendon, AF, NP, cartilage, fat, skin, muscle, spinal cord, brain, and lens. Data represent log2 values of the normalized expression ratios (see Materials and Methods for details). SDC4 expression is high in NP compared with other tissues and other SDC isoforms. B) Expression ratios for SDC4 from different rat tissues (cyanine 5 intensity from sample/cyanine 3 intensity of rat common reference RNA). Analysis shows high relative expression of SDC4 message in the rat NP tissue compared with other tissues. C) Immunohistochemical staining of SDC4 on embryonic section of rat intervertebral disc shows robust and enriched SCD4 staining in the NP compared to surrounding tissues. D) Real-time RT-PCR analysis of SDC4 in NP cells cultured under hypoxic (Hx) condition. Expression was significantly induced by 8 h in Hx compared to normoxia (Nx). E) Western blot analysis of SDC4 expression in rat NP cells cultured under Hx for 24 h. SDC4 levels are elevated by Hx. F) Densitometric analysis of multiple blots from experiment in D shows significant induction in SDC4 protein levels by Hx. Values are means ± se of 3 independent experiments. *P < 0.05.
Next, we evaluated whether hypoxic regulation of SDC4 expression is dependent on HIF. Analysis of 2.7 kb of SDC4 promoter from various vertebrate species using the ECR genome browser showed multiple areas of high evolutionary conservation relative to the human sequence (Fig. 2A). Further analysis with the Jaspar core database indicates that a putative HRE is located at −696/−689 bp (AGGCGTGA) in human SDC4 promoter (Fig. 2B). To evaluate the functional significance of this HRE in oxemic regulation of SDC4 promoter activity, we generated a SDC4 reporter construct-containing mutation (AGGAAAAA) in HRE (SDC4-HRE-MT; Fig. 2B). Figure 2C shows that in rat NP cells, wild-type SDC4 promoter activity is significantly induced under the hypoxic condition. In contrast, the HRE mutation completely abolishes this induction of SDC4 reporter (SDC4-HRE-MT). In addition, we observed that while wild-type SDC4 promoter activity is significantly increased by treatment with DMOG, an inhibitor of PHD function, SDC4-HRE-MT reporter showed no increase (Fig. 2D, E). We then determined whether treatment of rat NP cells with DMOG induces SDC4 mRNA expression. Figure 2F shows that the expression of SDC4 is significantly up-regulated at 24 h by DMOG treatment.
Figure 2.
Contribution of HRE in SDC4 promoter in hypoxic induction in NP cells. A) ECR genome browser shows pairwise alignment of several vertebrate SDC4 gene sequences with conservation relative to the human sequence. The x axis represents base positions in the genome; the y axis represents the percent identity between aligned bases at the specific position. Thus, the peaks represent regions of higher conservation, with the pink line above the peaks denoting ECRs that have ≥80% identity with the human sequence. The promoter region is shown in red, coding region in blue, untranslated region in yellow, transposons and simple repeats in green, and intronic sequences in peach. Note that several regions of high evolutionary conservation in the promoter region are conserved through several vertebrate species. B) Schematic of SDC4 promoter fragments in luciferase constructs used for transfections (HRE-WT and HRE-MT). Putative HRE is located at −696/−689 bp (AGGCGTGA). A mutation in the HRE is introduced by site-directed mutagenesis (AGGAAAAA). C) While SDC4-WT shows hypoxic induction in activity, mutation of the HRE (HRE-MT) abolishes hypoxic induction in activity. D) SDC4-WT promoter activity is significantly increased by treatment with DMOG, a pan-PHD inhibitor. E) SDC4 promoter with HRE mutation (HRE-MT) shows no induction when treated with DMOG. F) Real-time RT-PCR analysis of SDC4 in rat NP cells treated with DMOG, inhibitor of PHD enzymatic activity. SDC4 expression was significantly induced at 24 h. Data represent means ± se of 3 independent experiments performed in triplicate (n=3). ns, not significant. *P < 0.05.
Since our previous work has identified a positive relationship between PHD3 and NF-κB signaling (29), and as SDC4 expression is NF-κB sensitive in NP cells (18), we investigated whether the pan-PHD inhibitor robustly influenced NF-κB signaling. We measured the activation status of prototype NF-κB responsive (3xNF-κB-Luc) and hypoxia responsive (Pgk1-3xHRE-Luc) reporters following DMOG treatment of rat NP cells. Although the activity of 3xNF-κB-Luc is not influenced, Pgk1-3xHRE-Luc is significantly induced by DMOG in a dose-dependent manner (Fig. 3A). To further confirm that DMOG-mediated induction of SDC4 is independent of NF-κB binding to its promoter, we measured the activity of SDC4 promoter construct harboring mutation in NF-κB responsive element (SDC4-NRE-MT). Figure 3B shows that SDC4-NRE-MT activity is significantly induced by DMOG in a dose-dependent manner. As such, hypoxia induced SDC4-NRE-MT activity in rat NP cells, indicating lack of NF-κB involvement in this process (Fig. 3C).
Figure 3.
Increase in SDC4 expression following inhibition of PHD activity is independent of NF-κB signaling. A) Top panel: schematic of 3xNF-κB-luc and Pgk1-3xHRE-luc used for transfections. Bottom panel: activity of 3xNF-κB-luc is not influenced, while Pgk1-3xHRE-luc is significantly induced by DMOG in a dose-dependent manner, indicating sustained activation of HIF but not NF-κB signaling. B) Top panel: schematic of NRE mutant SDC4 reporter used for transfections. Bottom panel: note that SDC4-NRE-MT promoter activity is significantly induced by DMOG in a dose-dependent manner. C) Activity of SDC4-NRE-MT is increased by hypoxia (Hx) in rat NP cells, indicating sole contribution of HIF to this induction. Data represent means ± se of 3 independent experiments performed in triplicate (n=3). ns, not significant. *P < 0.05.
To further investigate whether the expression of SDC4 is specifically regulated by PHD2 through HIF-1α accumulation, PHD2 gain- and loss-of-function studies were performed in rat NP cells. Overexpression of PHD2 significantly suppressed both Pgk1-3xHRE-Luc and wild-type SDC4 promoter activities (Fig. 4A), while 3x-NF-κB-Luc activity remained unaffected. In contrast, cotransfection of Sh-PHD2 resulted in significant induction in activity of Pgk1-3xHRE-Luc and, more important, SDC4 promoter; again, no effect on prototype 3x-NF-κB-Luc was seen (Fig. 4B). To measure the effect of stable suppression of PHD2 on SDC4 expression, we transduced rat NP cells with a lentivirus expressing Sh-PHD2 under both normoxic and hypoxic conditions. The assessment of GFP-positive cells confirmed high transduction efficiency (Fig. 4C). Real-time RT-PCR (Fig. 4D) and Western blot (Fig. 4E) analysis confirmed that the mRNA and protein expression of PHD2 is significantly suppressed in the cells transduced with Sh-PHD2, compared to cells transduced with Sh-control. Notably, regardless of the oxemic status, PHD2 suppressed rat NP cells evidenced by a significant increase in SDC4 mRNA (Fig. 4D) and protein (Fig. 4E) expression under both normoxic and hypoxic condition. Densitometric studies confirmed significant increase in SDC4 protein levels in PHD2-silenced cells (Fig. 4F). In agreement with previous reports (11, 12), sh-PHD2 transduction of rat NP cells resulted in accumulation of HIF-1α under both normoxic and hypoxic conditions (Fig. 4E, F).
Figure 4.
Effect of PHD2 modulation on the expression of SDC4 in NP cells. A) Cotransfection of PHD2 resulted in decrease in activities of Pgk1-3xHRE-luc (HRE) and SDC4 promoter (SDC4-WT) in rat NP cells. In contrast, 3xNF-κB-luc (NRE) activity remained unchanged by PHD2. B) Activities of HRE and SDC4-WT, but not NRE, were significantly induced by cotransfection with Sh-PHD2. C) GFP signal from rat NP cells transduced with a lentivirus coexpressing GFP and PHD2 ShRNA (LV-Sh-PHD2) shows high transduction efficiency. View ×20. D, E) Real-time RT-PCR (D) and Western blot analysis (E) of PHD2 and SDC4 in rat NP cells transduced with LV-Sh-control or LV-Sh-PHD2 under normoxia (NX) and hypoxia (HX). PHD2 suppression resulted in significant increase in SDC4 mRNA and protein expression in both NX and HX. PHD2 suppression also resulted in increased HIF-1α protein levels. F) Densitometric analysis of 3 independent Western blot experiments in D shows that transduction of cells with lentiviral PHD2 ShRNA (LV-ShPHD2) resulted in an increase in HIF-1α and SDC4 protein levels in both NX and HX. Data represent means ± se of 3 independent experiments performed in triplicate (n=3). ns, not significant. *P < 0.05.
To further investigate which HIF-α homologue contributes to regulation of SDC4 expression, HIF-α gain-of-function studies were performed. We first validated that the activity of Pgk1-3xHRE-luc reporter is significantly induced by cotransfection by both HIF-1α and HIF-2α in rat NP cells (Fig. 5A). Interestingly, while SDC4 promoter activity is induced when HIF-1α is coexpressed, HIF-2α showed no effect on the promoter activity (Fig. 5B). To measure the effect of stable overexpression of HIF-1α on SDC4 protein levels, we transduced rat NP cells with lentivirus expressing CA-HIF-1α. The assessment of GFP-expressing cells confirmed that the transduction efficiency was high (Fig. 5C). As expected, Western blot analysis confirmed that there is an increase in HIF-1α protein level in the transduced cells (Fig. 5D). Moreover, we found that the HIF-1α transduced cells show increased SDC4 expression (Fig. 5D). Densitometric analysis confirmed that the increase in SDC4 is correlated with the accumulation of HIF-1α (Fig. 5E).
Figure 5.
Regulation of SDC4 expression is dependent on HIF-1α but not HIF-2α in NP cells. A) Activity of Pgk1-3xHRE-luc (HRE-luc) is significantly induced by cotransfection of either HIF-1α or HIF-2α in rat NP cells. Β) SDC4 promoter activity is induced by overexpression of HIF-1α but not HIF-2α. C) Analysis of GFP in rat NP cells transduced with control lentivirus expressing GFP (LV-control) shows high transduction efficiency. View ×20. D) Western blot analysis of cells transduced with LV-control or LV-CAHIF-1α. HIF-1α was accumulated in LV-CAHIF-1α transduced rat NP cells compared to control. Overexpression of HIF-1α under normoxic conditions resulted in the induction of SDC4 protein levels. E) Densitometric analysis of multiple blots from experiment in D. As expected, relative HIF-1α level in LV-CAHIF-1α group was higher compared to control. Expression of SDC4 was significantly increased in cells transduced with LV-CAHIF-1α. Data represent means ± se of 3 independent experiments performed in triplicate (n=3). ns, not significant. *P < 0.05.
We next stably suppressed the activity of HIF-1α or HIF-1β by transducing human NP cells with lentivirus expressing either HIF-1α or HIF-1β shRNA. Since functional HIF-1 and HIF-2 proteins require heterodimerization of the HIF-1α/2α and HIF-1β subunits, lack of a β subunit inhibits both HIF-1 and HIF-2 transcriptional activity. Figure 6A shows that high transduction efficiency was achieved by lentiviral sh-HIF-1α. Real-time RT-PCR analysis confirmed that mRNA expression of HIF-1α is suppressed in the cells transduced with Sh-HIF-1α, compared with Sh-control (Fig. 6B). HIF-1α-suppressed cells evidence a significant decrease in SDC4 mRNA expression, as well as HIF-1α target genes, VEGF, and enolase1 (Fig. 6B). Western blot analysis also shows that hypoxic suppression of HIF-1α in human NP cells results in decreased SDC4 protein levels (Fig. 6C). Densitometry analysis confirmed that the expression of SDC4 is dependent on HIF-1α levels (Fig. 6D). In addition, Western blot analysis confirms that hypoxic suppression of HIF-1β results in decreased levels of SDC4 (Fig. 6E).
Figure 6.
Role of HIF-1α in controlling SDC4 expression in NP cells. A) Analysis of YFP in human NP cells transduced with lentivirus coexpressing Sh-HIF-1α (LV-Sh-HIF-1α) with YFP shows high transduction efficiency. View ×20. B) Real-time RT-PCR of HIF-1α, SDC4, and HIF-1α target genes: VEGF and enolase1 in NP cells transduced with LV-Sh-control or LV-Sh-HIF-1α under hypoxia. HIF-1α suppression results in significant decrease in mRNA expression of SDC4, as well as VEGF and enolase1. C) Western blot analysis of human NP cells transduced with LV-Sh-control or LV-Sh-HIF-1α under hypoxia. Decrease in HIF-1α protein levels resulted in decreased SDC4 levels. D) Densitometric analysis of multiple blots from experiment described in C. Protein level of SDC4 is significantly decreased correlating with suppression of HIF-1α. E) Western blot analysis of cells transduced with LV-Sh-control or LV-Sh-HIF-1β. HIF-1β was suppressed by LV-Sh-HIF-1β compared with human NP cells transduced with control lentivirus (LV-Sh-control). Decreased HIF-1β protein levels resulted in decrease in SDC4 level. Data represent means ± se of 3 independent experiments performed in triplicate (n=3). ns, not significant. *P < 0.05.
Finally, to investigate the role of SDC4 in NP homeostasis, we evaluated whether SDC4 controls the activity of Sox9. For this purpose, we first measured the activity of a luciferase reporter that contains 4 repeats of an upstream 359 bp of Sox9 binding enhancer of Agc1 in conjunction with 519 bp of Agc1 promoter (4xA1-pAgc-Luc) in presence of surfen, a small molecular antagonist of HS (Fig. 7A). Interestingly, we found that the reporter activity (Fig. 7B), as well as Agc1 mRNA expression (Fig. 7C), is significantly increased by surfen, compared to control in rat NP cells. Next, we measured activity of 4xA1-pAgc-Luc reporter in rat NP cells following cotransfection with Sh-SDC4. Figure 7D shows that silencing of SDC4 results in significant increase in the reporter activity. To further validate these findings by stably silencing SDC4, we transduced rat NP cells with lentivirus expressing Sh-SDC4. High transduction efficiency (∼70%) was observed, as determined by GFP positivity (Fig. 7E). Real-time RT-PCR (Fig. 7F) and Western blot analysis (Fig. 7G) indicate that there was a robust suppression of SDC4 expression. Notably, mRNA expression of Sox9 was significantly induced in SDC4-silenced rat NP cells (Fig. 7F). Western blot analysis and subsequent densitometric analysis confirmed that at the protein level, expression of Sox9 is significantly increased in SDC4-silenced cells (Fig. 7G, H).
Figure 7.
SDC4 regulates Sox9 expression in NP cells. A) Schematic of [4xA1]-pAgc-Luc reporter used to measure Sox9 activity. Reporter contains 359 bp Sox9-responsive enhancer and 596 bp of proximal promoter of mouse Agc1 gene. B) [4xA1]-pAgc-Luc reporter activity is significantly induced by surfen (7.5 μM), antagonist of HS, compared to control. C) Real-time RT-PCR analysis shows that surfen treatment induced Agc1 mRNA expression by rat NP cells. D) Activity of 4xA1-pAgc-Luc reporter in rat NP cells is suppressed with cotransfection of Sh-SDC4. E) Analysis of GFP in rat NP cells transduced with lentivirus coexpressing GFP and ShRNA of SDC4 (LV-Sh-SDC4) shows high transduction efficiency. View ×20. F) Real-time RT-PCR analysis of SDC4 and Sox9 in rat NP cells transduced with LV-Sh-control or LV-Sh-SDC4 under hypoxia. A significant reduction in SDC4 was accompanied by a concomitant increase in Sox9 in rat NP cells transduced with LV-Sh-SDC4. G) Western blot analysis of rat NP cells transduced with LV-Sh-control or LV-Sh-SDC4 under hypoxia. Decrease in SDC4 was accompanied by an increase in Sox9 levels. H) Densitometric analysis of multiple blots from experiment in G. Sox9 protein levels are significantly elevated in SDC4-suppressed NP cells. Quantitative data represent means ± se of 3 independent experiments performed in triplicate (n=3). ns, not significant. *P < 0.05.
DISCUSSION
The experiments described in this investigation demonstrated for the first time that in NP cells, expression of SDC4 was controlled by oxemic tension. Our studies also revealed that HIF-1α, and not HIF-2α, controlled hypoxic regulation of SDC4 expression. A second major observation was that SDC4 modulated the expression of Sox9, a key transcriptional regulator of Agc1 expression in NP cells. These findings lend strong support to the hypothesis that in the hypoxic intervertebral disc, SDC4 is important in homeostatic maintenance of the NP.
We have previously shown that inflammatory cytokines associated with disc disease, TNF-α and IL-1β, regulated SDC4 expression through NF-κB signaling and that SDC4 was responsible for promoting Agc1 degradation through controlling ADAMTS-5 activity in NP cells (18). Interestingly, we noted that SDC4 is enriched in healthy NP tissue compared with other tissues, including AF and cartilage, a likely reflection of its notochordal nature and unique tissue microenvironment. This led us to formulate two questions: first, what is the major signaling pathway that controls physiological expression of SDC4 in NP cells, and second, what is the physiological function of SDC4 in NP cells? We investigated the role of hypoxia, one of the most important niche factors controlling expression of this molecule. Results clearly show that SDC4 is a hypoxia-sensitive gene and that the regulation is dependent on the PHD2-HIF-1α axis in NP cells. While some studies have reported that inhibition of PHDs stimulates NF-κB signaling (24, 30–32), our own studies have shown a positive relationship between PHD3 and NF-κB signaling in NP cells (29). Although PHD3 controlled NF-κB activation independent of its hydroxylase activity in NP cells (29), it was important to investigate the possibility of whether functional inhibition of other PHD homologues PHD1 and PHD2 by DMOG positively affected NF-κB signaling, as observed in other cell types, thus influencing SDC4 expression (30, 31). Our results clearly suggest that inhibition of PHD is not sufficient to activate prototypical NF-κB-sensitive reporter. Moreover, that the activity of SDC4 promoter with NRE mutation is induced by DMOG and that the silencing of PHD2 did not affect activity of 3xNF-κB-Luc indicated that PHD2 mediated its effects solely through HIF-1α accumulation. These findings were further validated by HIF gain- and loss-of-function studies, demonstrating the important role of HIF-1α in this regulation. Taken together, our results clearly indicate that in the healthy state, PHD2-HIF-1α system controls SDC4 expression in NP cells and that the expression is responsive to the prevalent niche conditions and signaling pathways, i.e., hypoxia and HIF-1 under physiological and TNF-α, IL-1β, and NF-κB under pathological conditions. Notably, HIF-2α did not contribute in controlling SDC4 expression, a finding consistent with previous report that in NP cells, HIF-2α levels are independent of PHD2 function.
Next, we investigated the function of SDC4 in healthy disc. Our results clearly suggest that hypoxia and HIF-driven SDC4 in NP cells through its HS side chains were important in controlling basal mRNA expression of Sox9, a key transcriptional regulator of Agc1 and collagen II. Our results are in agreement with recent studies that showed that blocking HS function with surfen in micromass cultures of limb bud mesenchyme increased cellular responsiveness to BMP signaling and promoted chondrogenesis, as evidenced by elevated Sox9 and Agc1 mRNA expression (33). Thus, these micromass studies suggest that cell surface HS proteoglycans modulate BMP bioavailability to cells and may play an active role in maintenance of chondrogenic phenotype (33). Relevant to this discussion is the study by Tim et al. (34) that showed up-regulation of Sox9 expression in intervertebral disc cells by BMP-2. In addition, HS proteoglycans SDC1 and SDC4 have been shown to modulate Wnt (35, 36), as well as Shh signaling (16). Notably, the Wnt and Shh pathway promotes chondrocyte and NP cell phenotype in a Sox9-dependent manner (37, 38). Therefore, sequestration of several growth factors and precise control of their bioavailabilty and, thus, activity, is a critical function of cell surface proteoglycans, such as SDC4. This is especially critical, as uncontrolled growth factor signaling is known to promote disc degeneration (39). Therefore, it is possible that in the physiologically hypoxic niche of the NP, SDC4 through its HS side chains may control Sox9 mRNA expression and thus subsequent transcriptional activity through modulating activity of BMP, Wnt, Shh, or all of these growth factor-signaling pathways. It is noteworthy that hypoxia has been shown to increase Sox9 mRNA levels in NP cells (40). This raises an interesting possibility: that a fine balance between transcriptional activation by HIF-1 or HIF-2, as seen in MSCs and chondrocytes (41–43), and transcriptional repression by HIF-1-dependent SDC4 precisely maintains Sox9 levels in the hypoxic NP. Experiments are in progress to test this premise. Taken together, findings of this study lend strong support to the hypothesis that in the hypoxic niche of the healthy discs, this cell surface HS proteoglycan plays a critical role in NP tissue homeostasis and maintenance of cell phenotype through precisely controlling Sox9 levels (see schematic in Fig. 8).
Figure 8.
Schematic showing context-dependent regulation and function of SDC4 in NP cells. In healthy disc, SDC4 levels are primarily controlled by hypoxia through HIF-1 signaling. In this state, cell surface SDC4 controls the bioavailability and activity of growth factors like BMP, Wnt, and SHH by biding and their sequestration through its HS side chains. This interaction controls the precise levels of Sox9 in NP cells and maintains their phenotype.
Supplementary Material
Acknowledgments
This work was supported by grants from the U.S. National Institutes of Health/National Institute of Arthritis and Musculoskeletal and Skin Diseases (R01-AR050087 and R01-AR055655).
The authors report no conflicts of interest.
This article includes supplemental data. Please visit http://www.fasebj.org to obtain this information.
- ADAMTS
- a disintegrin-like and metalloprotease with thrombospondin type I motifs
- AF
- annulus fibrosus
- Agc1
- aggrecan
- CA-HIF
- constitutively active HIF
- DMOG
- dimethyloxalylglycine
- ECR
- Evolutionary Conserved Regions
- HIF
- hypoxia-inducible factor
- HRE
- hypoxia response element
- HS
- heparan sulfate
- NP
- nucleus pulposus
- Pgk1
- phosphoglycerate kinase 1
- PHD
- prolyl-4-hydroxylase domain
- SDC
- syndecan
- Sox9
- sex-determining region Y (SRY)-box 9
REFERENCES
- 1. Gruber H. E., Ashraf N., Kilburn J., Williams C., Norton H. J., Gordon B. E., Hanley E. N., Jr. (2005) Vertebral endplate architecture and vascularization: application of micro-computerized tomography, a vascular tracer, and immunocytochemistry in analyses of disc degeneration in the aging sand rat. Spine 30, 2593–2600 [DOI] [PubMed] [Google Scholar]
- 2. Hassler O. (1969) The human intervertebral disc. A micro-angiographical study on its vascular supply at various ages. Acta Orthop. Scand. 40, 765–772 [DOI] [PubMed] [Google Scholar]
- 3. Rudert M., Tillmann B. (1993) Lymph and blood supply of the human intervertebral disc. Cadaver study of correlations to discitis. Acta Orthop. Scand. 64, 37–40 [DOI] [PubMed] [Google Scholar]
- 4. Bartels E. M., Fairbank J. C., Winlove C. P., Urban J. P. (1998) Oxygen and lactate concentrations measured in vivo in the intervertebral discs of patients with scoliosis and back pain. Spine 23, 1–7 [DOI] [PubMed] [Google Scholar]
- 5. Semenza G. L., Roth P. H., Fang H. M., Wang G. L. (1994) Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J. Biol. Chem. 269, 23757–23763 [PubMed] [Google Scholar]
- 6. Rajpurohit R., Risbud M. V., Ducheyne P., Vresilovic E. J., Shapiro I. M. (2002) Phenotypic characteristics of the nucleus pulposus: expression of hypoxia inducing factor-1, glucose transporter-1 and MMP-2. Cell Tissue Res. 308, 401–407 [DOI] [PubMed] [Google Scholar]
- 7. Risbud M. V., Guttapalli A., Stokes D. G., Hawkins D., Danielson K. G., Schaer T. P., Albert T. J., Shapiro I. M. (2006) Nucleus pulposus cells express HIF-1 alpha under normoxic culture conditions: a metabolic adaptation to the intervertebral disc microenvironment. J. Cell. Biochem. 98, 152–159 [DOI] [PubMed] [Google Scholar]
- 8. Agrawal A., Guttapalli A., Narayan S., Albert T. J., Shapiro I. M., Risbud M. V. (2007) Normoxic stabilization of HIF-1α drives glycolytic metabolism and regulates aggrecan gene expression in nucleus pulposus cells of the rat intervertebral disk. Am. J. Physiol. Cell Physiol. 293, C621–C631 [DOI] [PubMed] [Google Scholar]
- 9. Agrawal A., Gajghate S., Smith H., Anderson D. G., Albert T. J., Shapiro I. M., Risbud M. V. (2008) Cited2 modulates hypoxia-inducible factor-dependent expression of vascular endothelial growth factor in nucleus pulposus cells of the rat intervertebral disc. Arthritis Rheum. 58, 3798–3808 [DOI] [PubMed] [Google Scholar]
- 10. Zeng Y., Danielson K. G., Albert T. J., Shapiro I. M., Risbud M. V. (2007) HIF-1α is a regulator of galectin-3 expression in the intervertebral disc. J Bone Miner. Res. 22, 1851–1861 [DOI] [PubMed] [Google Scholar]
- 11. Tran C. M., Fujita N., Huang B. L., Ong J. R., Lyons K. M., Shapiro I. M., Risbud M. V. (2013) Hypoxia-inducible factor (HIF)-1α and CCN2 form a regulatory circuit in hypoxic nucleus pulposus cells: CCN2 suppresses HIF-1α level and transcriptional activity. J. Biol. Chem. 288, 12654–12666 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Fujita N., Chiba K., Shapiro I. M., Risbud M. V. (2012) HIF-1α and HIF-2α degradation is differentially regulated in nucleus pulposus cells of the intervertebral disc. J. Bone Miner. Res. 27, 401–412 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Fujita N., Markova D., Anderson D. G., Chiba K., Toyama Y., Shapiro I. M., Risbud M. V. (2012) Expression of prolyl hydroxylases (PHDs) is selectively controlled by HIF-1 and HIF-2 proteins in nucleus pulposus cells of the intervertebral disc: distinct roles of PHD2 and PHD3 proteins in controlling HIF-1α activity in hypoxia. J. Biol. Chem. 287, 16975–16986 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Sowter H. M., Raval R. R., Moore J. W., Ratcliffe P. J., Harris A. L. (2003) Predominant role of hypoxia-inducible transcription factor (Hif)-1α versus Hif-2α in regulation of the transcriptional response to hypoxia. Cancer Res. 63, 6130–6134 [PubMed] [Google Scholar]
- 15. Tkachenko E., Rhodes J. M., Simons M. (2005) Syndecans: new kids on the signaling block. Circ. Res. 96, 488–500 [DOI] [PubMed] [Google Scholar]
- 16. Chang S. C., Mulloy B., Magee A. I., Couchman J. R. (2011) Two distinct sites in sonic Hedgehog combine for heparan sulfate interactions and cell signaling functions. J. Biol. Chem. 286, 44391–44402 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Chen Y., Abraham D. J., Shi-Wen X., Pearson J. D., Black C. M., Lyons K. M., Leask A. (2004) CCN2 (connective tissue growth factor) promotes fibroblast adhesion to fibronectin. Mol. Biol. Cell 15, 5635–5646 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Wang J., Markova D., Anderson D. G., Zheng Z., Shapiro I. M., Risbud M. V. (2011) TNF-α and IL-1β promote a disintegrin-like and metalloprotease with thrombospondin type I motif-5-mediated aggrecan degradation through syndecan-4 in intervertebral disc. J. Biol. Chem. 286, 39738–39749 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Okuyama E., Suzuki A., Murata M., Ando Y., Kato I., Takagi Y., Takagi A., Murate T., Saito H., Kojima T. (2013) Molecular mechanisms of syndecan-4 upregulation by TNF-α in the endothelium-like EAhy926 cells. J. Biochem. 154, 41–50 [DOI] [PubMed] [Google Scholar]
- 20. Echtermeyer F., Bertrand J., Dreier R., Meinecke I., Neugebauer K., Fuerst M., Lee Y. J., Song Y. W., Herzog C., Theilmeier G., Pap T. (2009) Syndecan-4 regulates ADAMTS-5 activation and cartilage breakdown in osteoarthritis. Nat Med. 15, 1072–1076 [DOI] [PubMed] [Google Scholar]
- 21. Smith M. F., Jr., Novotny J., Carl V. S., Comeau L. D. (2006) Helicobacter pylori and Toll-like receptor agonists induce syndecan-4 expression in an NF-κB-dependent manner. Glycobiology 16, 221–229 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Han Y., Lefebvre V. (2008) L-Sox5 and Sox6 drive expression of the aggrecan gene in cartilage by securing binding of Sox9 to a far-upstream enhancer. Mol. Cell. Biol. 28, 4999–5013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Yeramian A., Santacana M., Sorolla A., Llobet D., Encinas M., Velasco A., Bahi N., Eritja N., Domingo M., Oliva E., Dolcet X., Matias-Guiu X. (2011) Nuclear factor-κB2/p100 promotes endometrial carcinoma cell survival under hypoxia in a HIF-1α independent manner. Lab. Invest. 91, 859–871 [DOI] [PubMed] [Google Scholar]
- 24. Fu J., Taubman M. B. (2010) Prolyl hydroxylase EGLN3 regulates skeletal myoblast differentiation through an NF-κB-dependent pathway. J. Biol. Chem. 285, 8927–8935 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Johansen J. L., Sager T. N., Lotharius J., Witten L., Mørk A., Egebjerg J., Thirstrup K. (2010) HIF prolyl hydroxylase inhibition increases cell viability and potentiates dopamine release in dopaminergic cells. J. Neurochem. 115, 209–219 [DOI] [PubMed] [Google Scholar]
- 26. Fujita N., Miyamoto T., Imai J., Hosogane N., Suzuki T., Yagi M., Morita K., Ninomiya K., Miyamoto K., Takaishi H., Matsumoto M., Morioka H., Yabe H., Chiba K., Watanabe S., Toyama Y., Suda T. (2005) CD24 is expressed specifically in the nucleus pulposus of intervertebral discs. Biochem. Biophys. Res. Commun. 338, 1890–1896 [DOI] [PubMed] [Google Scholar]
- 27. Sun Q., Zhou H., Binmadi N. O., Basile J. R. (2009) Hypoxia-inducible factor-1-mediated regulation of semaphorin 4D affects tumor growth and vascularity. J. Biol. Chem. 284, 32066–32074 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Kong T., Westerman K. A., Faigle M., Eltzschig H. K., Colgan S. P. (2006) HIF-dependent induction of adenosine A2B receptor in hypoxia. FASEB J. 20, 2242–2250 [DOI] [PubMed] [Google Scholar]
- 29. Fujita N., Gogate S. S., Chiba K., Toyama Y., Shapiro I. M., Risbud M. V. (2012) Prolyl hydroxylase 3 (PHD3) modulates catabolic effects of tumor necrosis factor-α (TNF-α) on cells of the nucleus pulposus through co-activation of nuclear factor κB (NF-κB)/p65 signaling. J. Biol. Chem. 287, 39942–39953 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Adluri R. S., Thirunavukkarasu M., Dunna N. R., Zhan L., Oriowo B., Takeda K., Sanchez J. A., Otani H., Maulik G., Fong G. H., Maulik N. (2011) Disruption of hypoxia-inducible transcription factor-prolyl hydroxylase domain-1 (PHD-1-/-) attenuates ex vivo myocardial ischemia/reperfusion injury through hypoxia-inducible factor-1α transcription factor and its target genes in mice. Antioxid. Redox Signal. 15, 1789–1797 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Takeda Y., Costa S., Delamarre E., Roncal C., Leite de Oliveira R., Squadrito M. L., Finisguerra V., Deschoemaeker S., Bruyère F., Wenes M., Hamm A., Serneels J., Magat J., Bhattacharyya T., Anisimov A., Jordan B. F., Alitalo K., Maxwell P., Gallez B., Zhuang Z. W., Saito Y., Simons M., De Palma M., Mazzone M. (2011) Macrophage skewing by Phd2 haplodeficiency prevents ischaemia by inducing arteriogenesis. Nature 479, 122–126 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Xue J., Li X., Jiao S., Wei Y., Wu G., Fang J. (2010) Prolyl hydroxylase-3 is down-regulated in colorectal cancer cells and inhibits IKKβ independent of hydroxylase activity. Gastroenterology 138, 606–615 [DOI] [PubMed] [Google Scholar]
- 33. Huegel J., Mundy C., Sgariglia F., Nygren P., Billings P. C., Yamaguchi Y., Koyama E., Pacifici M. (2013) Perichondrium phenotype and border function are regulated by Ext1 and heparan sulfate in developing long bones: a mechanism likely deranged in hereditary multiple exostoses. Dev. Biol. 377, 100–112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Tim Y. S., Kim S. K., Li J., Soo Park J., Akamaru T., Elmer W. A., Hutton W. C. (2003) The effect of bone morphogenetic protein-2 on rat intervertebral disc cells in vitro. Spine 28, 1773–1780 [DOI] [PubMed] [Google Scholar]
- 35. O'Connell M. P., Fiori J. L., Kershner E. K., Frank B. P., Indig F. E., Taub D. D., Hoek K. S., Weeraratna A. T. (2009) Heparan sulfate proteoglycan modulation of Wnt5A signal transduction in metastatic melanoma cells. J. Biol. Chem. 284, 28704–28712 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Fuerer C., Habib S. J., Nusse R. (2010) A study on the interactions between heparan sulfate proteoglycans and Wnt proteins. Dev. Dyn. 239, 184–190 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Yano F., Kugimiya F., Ohba S., Ikeda T., Chikuda H., Ogasawara T., Ogata N., Takato T., Nakamura K., Kawaguchi H., Chung U. I. (2005) The canonical Wnt signaling pathway promotes chondrocyte differentiation in a Sox9-dependent manner. Biochem. Biophys. Res. Commun. 333, 1300–1308 [DOI] [PubMed] [Google Scholar]
- 38. Dahia C. L., Mahoney E., Wylie C. (2012) Shh signaling from the nucleus pulposus is required for the postnatal growth and differentiation of the mouse intervertebral disc. PLoS One 7, e35944. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Cully M. (2013) Degenerative disc disease: Altered Wnt signalling in intervertebral disc degeneration. Nat. Rev. Rheumatol. 9, 136. [DOI] [PubMed] [Google Scholar]
- 40. Risbud M. V., Fertala J., Vresilovic E. J., Albert T. J., Shapiro I. M. (2005) Nucleus pulposus cells upregulate PI3K/Akt and MEK/ERK signaling pathways under hypoxic conditions and resist apoptosis induced by serum withdrawal. Spine 30, 882–889 [DOI] [PubMed] [Google Scholar]
- 41. Robins J. C., Akeno N., Mukherjee A., Dalal R. R., Aronow B. J., Koopman P., Clemens T. L. (2005) Hypoxia induces chondrocyte-specific gene expression in mesenchymal cells in association with transcriptional activation of Sox9. Bone 37, 313–322 [DOI] [PubMed] [Google Scholar]
- 42. Amarilio R., Viukov S. V., Sharir A., Eshkar-Oren I., Johnson R. S., Zelzer E. (2007) HIF1α regulation of Sox9 is necessary to maintain differentiation of hypoxic prechondrogenic cells during early skeletogenesis. Development 134, 3917–3928 [DOI] [PubMed] [Google Scholar]
- 43. Lafont J. E., Talma S., Murphy C. L. (2007) Hypoxia-inducible factor 2α is essential for hypoxic induction of the human articular chondrocyte phenotype. Arthritis Rheum. 56, 3297–3306 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
