SLC25A23 augments mitochondrial Ca²⁺ uptake, interacts with MCU, and induces oxidative stress–mediated cell death

Silencing of SLC25A23 modulates mitochondrial Ca²⁺ uptake

To explore the role of SLC25 isoforms, we stably knocked down SLC25A23, SLC25A24, and SLC25A25 using lentiviral short hairpin RNA (shRNA; Mallilankaraman et al., 2012a). We subjected puromycin-resistant, stably expressing lentiviral shRNA HeLa cell clones to quantitative real-time (qRT) PCR to assess SLC25 mRNA levels (Figure 1, A–C). We next examined whether the SLC25A23 #864 shRNA was exclusively on-target, by assessing mRNA levels of SLC25A23, SLC25A24, and SLC25A25 in the SLC25A23 #864 shRNA HeLa clone. As expected, SLC25A23 but not SLC25A24 or SLC25A25 mRNA was knocked down (Supplemental Figure S1), confirming the specificity of the #864 shRNA. HeLa cell maximal knockdown clones #864, #594, and #739 for SLC25A23, SLC25A24, and SLC25A25, respectively, were assayed using confocal microscopy for cytosolic Ca²⁺ (Fluo-4) and mitochondrial Ca²⁺ (Rhod-2 AM) dynamics after stimulation with the G-protein–coupled receptor (GPCR) agonist histamine (100 μM; Madesh et al., 2005; Hawkins et al., 2010a, b; Davidson and Duchen, 2012; Mallilankaraman et al., 2012a, b). SLC25A23 knockdown (KD) but not SLC25A24 KD or SLC25A25 KD exhibited diminished mitochondrial Ca²⁺ uptake (Figure 1, D–F, bottom left). To complement the rhod-2 AM results, we transfected HeLa SLC25A23 KD, SLC25A24 KD, and SLC25A25 KD clones with the genetic mitochondrial Ca²⁺ reporter GCaMP2-mt and assayed after histamine (100 μM) stimulation. GCaMP2-mt fluorescence corroborated that SLC25A23 KD reduces mitochondrial Ca²⁺ uptake, whereas SLC25A24 KD and SLC25A25 KD are unaltered (Figure 1, G–J). Having observed a reduction of mitochondrial Ca²⁺ uptake by SLC25A23 KD but not SLC25A24 KD or SLC25A25 KD, we assessed cytosolic Ca²⁺ clearance after histamine stimulation. Cytosolic Ca²⁺ measured by Fluo-4 was examined in an extended time interval to evaluate whether decreased mitochondrial Ca²⁺ uptake in SLC25A23 KD reciprocally sustained cytosolic [Ca²⁺] (Quintana et al., 2007). HeLa SLC25A23 KD and Neg shRNA cells were challenged with histamine, and fluorescence was recorded for 1000 s (Figure 1K). Quantitation of the cytosolic Ca²⁺ fluorescence area under the curve demonstrated marked deceleration of cytosolic Ca²⁺ clearance (Figure 1L).

SLC25A23 KD decreases mitochondrial Ca²⁺ uptake without altering efflux rate

To demonstrate that indeed SLC25A23 KD reduced mitochondrial Ca²⁺ uptake, we suspended permeabilized HeLa cells in intracellular matrix (ICM) buffer containing succinate to energize the mitochondria, thapsigargin to inhibit ER Ca²⁺ uptake via sarco/endoplasmic reticulum Ca²⁺ ATPase (SERCA), and added Fura-2FF to monitor extramitochondrial changes. We then pulsed cells with 10 μM Ca²⁺ to measure the mitochondrial Ca²⁺ uptake rate. Although the influx pathway is described by the rapid Ca²⁺ uptake channel MCU, Ca²⁺ efflux is mediated by the Na⁺/Ca²⁺ exchanger, with a distinct, relatively slow kinetic rate. Ca²⁺ efflux was measured by blocking the major Ca²⁺ uptake channel, the mitochondrial uniporter, with Ru360 (Zhou et al., 1998; Hajnoczky et al., 2006), followed by blockage of the mitochondrial Na⁺/Ca²⁺ exchanger with CGP37157 (Cox et al., 1993; Palty et al., 2010; Wei et al., 2011). Finally, uncoupler carbonyl cyanide m-chlorophenyl hydrazone (CCCP) was added to trigger release of all mitochondria-stored Ca²⁺, thus validating that equal amounts of total Ca²⁺ were pulsed. SLC25A23 KD only altered mitochondrial Ca²⁺ influx (Figure 2, A–C), whereas efflux rate and total mitochondrial [Ca²⁺] were unchanged (Figure 2, A, D, and E). Although statistically insignificant, a trend seemed to exist in the SLC25A23 KD total Ca²⁺ in which total SLC25A23 KD Ca²⁺ was reduced from Neg shRNA, presumably due to reduced influx rate. Knockdown of SLC25A24 and SLC25A25 did not alter influx rate, efflux rate, and total mitochondrial [Ca²⁺] (Supplemental Figure S2). The intact and permeabilized cell data indicate a SLC25A23 role in mitochondrial Ca²⁺ uptake.

SLC25A23 EF hands are necessary for mitochondrial Ca²⁺ uptake

SLC25A23 is predicted to be a multitransmembrane, mitochondrial-resident protein with three EF-hand motifs. After examining the EF-hand consensus sequence, we determined that only two of the three EF-hand motifs contain functional Ca²⁺-binding sites. To investigate the role of Ca²⁺-sensing properties of SLC25A23, we overexpressed GFP-tagged mutants of the two EF hands (EF1 D22A/E33K and EF2 D90A/E101K) in SLC25A23 KD cells (Figure 3A). Expression and mitochondrial localization were verified with mitochondrial membrane potential (ΔΨ_m) indicator tetramethylrhodamine ethyl ester (TMRE; Figure 3B). After verifying transient expression of SLC25A23 EF-hand mutants, we loaded HeLa cells with Rhod-2 AM and stimulated them with histamine. The EF-hand mutants exhibited a reduction of mitochondrial Ca²⁺ uptake (Figure 3, C and D). These data suggest that the EF hands are essential for SLC25A23 Ca²⁺ sensing and that SLC25A23 EF hands function to increase mitochondrial Ca²⁺ uptake.

SLC25A23 interacts with mitochondrial Ca²⁺ uniporter complex components MCU and MICU1

To determine the mechanism by which SLC25A23 modulates mitochondrial Ca²⁺ uptake, we asked whether SLC25A23 interacts with MCU or MICU1. Flag-tagged SLC25A23 was transfected into COS7 cells stably expressing GFP-tagged, full-length MCU or hemagglutinin (HA)-tagged full-length MICU1. The cell lysates from transfected cells were subjected to immunoprecipitation and Western blot analysis. Immunoprecipitation of GFP-tagged MCU pulled down SLC25A23 (Figure 4A) with MCU/MICU1 known interaction serving as a positive control. Correspondingly, HA-tagged MICU1 pulled down SLC25A23 (Figure 4B). The results of the coimmunoprecipitation demonstrate that SLC25A23 interacts with MCU and MICU1, two proteins believed to be of critical importance to mitochondrial Ca²⁺ influx.

Given that SLC25A23 interacts with MCU, we next sought to determine whether the knockdown of SLC25A23 modulates MCU activity (I_MCU). To measure I_MCU, we performed mitoplast patch clamping. In the patch clamp of whole-mitoplast configuration, the addition of 5 mM Ca²⁺ to the bath triggered an inwardly rectifying Ca²⁺ current, which was reduced in SLC25A23 KD mitoplasts in the nominal phosphate buffer condition (Figure 4, C and E). Because SLC25A23 was previously described as a Mg-ATP/Pi carrier (Fiermonte et al., 2004), we measured the I_MCU in Neg shRNA and SLC25A23 KD mitoplasts supplemented with 300 μM phosphate (Zoccarato and Nicholls, 1982; Figure 4, D and E). The I_MCU was increased by the presence of phosphate in Neg shRNA but not in SLC25A23 KD mitoplasts (Figure 4, C–E). This result suggests that the Mg-ATP/Pi carrier function of SLC25A23 enhances I_MCU activity.

Mitochondrial Ca²⁺ uptake reduction by SLC25A23 KD preserves ΔΨ_m

Because mitochondria Ca²⁺ uptake relies on ΔΨ_m as a driving force, we asked whether the reduced mitochondrial Ca²⁺ uptake exhibited by SLC25A23 knockdown was due to a difference in basal driving force, ΔΨ_m. HeLa cells with maximal knockdown (clone 864) and moderate knockdown (clone 863) and a SLC25A23 rescue construct (Figure 1A and Supplemental Figure S3) showed neither ΔΨ_m nor basal morphological phenotype changes when compared with a Neg shRNA HeLa cell clone, using two different ΔΨ_m indicators, TMRE and rhodamine 123 (Figure 5, A and B). These data show that SLC25A23 knockdown does not alter basal ΔΨ_m.

We next examined active-state mitochondrial Ca²⁺ handling and ΔΨ_m simultaneously using a permeabilized cell system loaded with cytosolic Ca²⁺ indicator Fura-2FF and ΔΨ_m indicator JC-1 (Madesh and Hajnoczky, 2001; Madesh et al., 2002, 2009; Roy et al., 2009; Mallilankaraman et al., 2012a, b). JC-1 is preferred to DiOC₆(3) and rhodamine 123 in ΔΨ_m studies when ΔΨ_m may collapse (Salvioli et al., 1997), which occurs when excessive Ca²⁺ is taken into the mitochondria. We found that the extramitochondrial delivery of Ca²⁺ pulses promoted a larger decay of ΔΨ_m in control shRNA HeLa cells than with SLC25A23 #864 knockdown HeLa cells (Figure 5, C and D). Intermediate knockdown of SLC25A23 (#863) partially preserved ΔΨ_m (Figure 5, C, bottom left, and D). We next verified SLC25A23’s role by reexpressing #864 shRNA–insensitive SLC25A23 cDNA. We were able to restore Ca²⁺ flux and associated ΔΨ_m (Figure 3, C, bottom right, and D). These results suggest that SLCA25A23 participates in mitochondrial Ca²⁺-uptake regulation.

SLC25A23 increases basal reactive oxygen species and decreases antioxidant levels

Because SLC25A23 is involved in Ca²⁺-activated adenine nucleotide transport, we examined mitochondrial DNA (mtDNA) copy number. Depletion of mitochondrial DNA copy number results in disassembly of electron transport chain components and thus drives reactive oxygen species (ROS) overproduction and mitochondrial malfunction (Hom et al., 2010). We found that KD of SLC25A23 did not alter mtDNA copy number in HeLa cells when compared with either negative or partial KD (#863) shRNA clones (Figure 6, A and B), supporting our finding of no gross mitochondrial abnormalities. In complement, we also studied the mitochondrial oxygen consumption rate (OCR) and NAD(P)H levels. Silencing of SLC25A23 in HeLa cells did not significantly alter mitochondrial OCR and NAD(P)H content (Supplemental Figure S4). We next investigated whether SLC25A23 KD affects mitochondrial ROS production. We assayed for mitochondrial superoxide (mROS) using the mitochondrial targeting superoxide indicator MitoSOX Red. Surprisingly, basal mROS levels were lower in SLC25A23 KD than in control (Figure 6, C and D), and reconstitution of SLC25A23 in clone #864 partially restored the mROS levels (Figure 6, C and D). However, mROS levels in SLC25A24 KD and SLC25A25 KD were similar to those in Neg shRNA cells. We next assessed whether levels of the major antioxidant glutathione changed in SLC25A23 KD cells. Indeed, reduced glutathione levels are higher in SLC25A23 KD (Figure 6, E and F). Together these results demonstrate that knockdown of SLC25A23 has no effect on basal mitochondrial bioenergetics but lowers basal mROS.

Knockdown of SLC25A23 protects cells from oxidative stress

Having observed reduction of mitochondrial Ca²⁺ uptake and mROS production during the basal state, we finally examined whether knockdown of SLC25A23 alleviates cell death during active mitochondrial Ca²⁺-overload conditions. SLC25A23 knockdown #864 and partial knockdown #863 both exhibited strong global preservation of ATP when compared with negative shRNA after ROS stressors (Figure 7A). Because ATP levels were preserved in the SLC25A23 KD, we performed a cell death assay using t-butyl hydroperoxide (t-BH) challenge. Oxidant-treated cells were stained with cell death markers annexin V and propidium iodide and imaged using confocal microscopy. Similar to the observed preservation of ATP levels, SLC25A23 KD was protective against t-BH stress, whereas SLC25A23 #864 rescue exhibited cell death comparable to negative shRNA HeLa cells (Figure 7, B and C). These results establish the role of SLCA25A23 as a link between mitochondrial Ca²⁺ uptake and cell death after oxidative stress.

Ca²⁺ uptake and ΔΨ_m measurement in permeabilized cell system

Mitochondrial Ca²⁺ uptake and ΔΨ_m were determined by simultaneous monitoring of cytosolic Ca²⁺ with Fura-2FF (0.5 μM; Life Technologies, Grand Island, NY) and ΔΨ_m with the lipophilic cationic dye 5,5′,6,6′-tetrachloro-3,3′-tetraethylbenzimi­dazolcarbocyanine (JC-1; 800 nM; Life Technologies) changes. Cells grown in T-75 flasks were trypsinized, neutralized with fetal bovine serum, centrifuged at 1500 rpm for 5 min, aspirated, resuspended in 20 ml of phosphate-buffered saline, centrifuged at 800 rpm for 3 min, aspirated, and then resuspended in ICM buffer containing 40 μg/ml digitonin to permeabilize the cells, protease inhibitors (EDTA-free cOMPLETE tablets; Roche Applied Science, Indianapolis, IN), and 2 μM thapsigargin to block the SERCA pump. Mitochondria were energized with 2 mM of succinate (Hawkins et al., 2010b), and then 8 × 10⁶ cells were resuspended in 1 ml of ICM buffer and followed by Fura-2FF as a cytosolic Ca²⁺ indicator. After 20 s of data recording, JC-1 was added. At 480 s and every 120 s thereafter, 10 μM Ca²⁺ was added. CCCP, 2 μM, was added at 1200 s. Fluorescence was measured using a dual-wavelength fluorimeter (PTI) with 490-nm excitation and 535-nm emission for monomeric JC-1 and 570/595 nm for the J-aggregate. The ΔΨ_m was calculated as the ratio of J-aggregate and the monomer (Irrinki et al., 2011).

Cell culture

HeLa cells were cultured using low-glucose DMEM (GIBCO, Life Technologies) containing 10% fetal bovine serum and 1% penicillin/streptomycin, with or without 2 μg/ml puromycin and with or without G418 (500 μg/ml). For each isoform—SLC25A23, SLC25A24, and SLC25A25—five shRNA constructs were expressed.

Generation of stable SLC25A23, SLC25A24, and SLC25A25 shRNA knockdown and rescue HeLa cell clones

The following shRNA sequences were obtained from Open Biosystems, Pittsburgh, PA: for SLC25A23, #863, CCTGAATCTTAGACTCTTATA; #864, CGAGTCAGCTATCAAGTTCAT; #865, CGGCTGAACAGAATCGTTCAA; #866, CGTCTACGAGACTCTGAAGAA; and #867, CTGCTCATGTTTCACAGTCTT; for SLC25A24, #592, GACACTGGGTCTGACTATTTC; #593, TATTAGGTATCATACCTTATG; #594, TGGCCTCTTTCGACGAATTAT; #595, TTCGGGTGGTTTACGTTTATG; and #720 ATGAGCTCTTGAAGTCCTATT; and for SLC25A25, #736, AGACCGAGTTCCAGTACTTTG; #737, CTGCCGAGCTGAAGTCCATTT; #738, GGGACTTGGGAGTCAAGATAT; #739, CCCGAATCAGCCATCAAATTC; and #740 CCCTCGTCCAATCCCATAATC. HeLa cells (5 × 10⁵/well) grown in six-well plates were transduced with the lentivirus for knockdown. Two days posttransduction, the cells were selected with puromycin (2 mg/ml) for 6–10 d and expanded. For the rescue studies, a SLC25A23 construct resistant to #864 shRNA knockdown was created (OriGene Technologies, Rockville, MD). The rescue plasmid encoding SLC25A23 cDNA harbored four silent point mutations in the region complementary to SLC25A23 shRNA. The #864 knockdown cells were transfected with SLC25A23 rescue construct, and the knockdown cells expressing shRNA-resistant SLC25A23 cDNAs were selected with 500 μg/ml G418 (Life Technologies).

qRT PCR analysis

The knockdown and overexpression were assessed by qRT PCR. Briefly, total RNA was isolated from HeLa wild type (WT), Neg shRNA, SLC25A23 KD, SLC25A24 KD, and SLC25A25 KD and rescue cells, using the RNeasy Mini Kit (Qiagen, Valencia, CA) in accordance with the manufacturer's instructions. Total RNA (1 μg) was reverse transcribed with the Verso cDNA Kit (Abgene, Cambridge, United Kingdom). Real-time qPCRs were performed with the gene-specific Solaris qPCR gene expression assay kit (Abgene) as per the manufacturer's instructions. (SLC25A23: forward primer, AACAGGGTATCTCCTCTGAG, reverse primer, AGTCTTGACCGGAACCAG, and probe, AGTCTTGACCGGAACCAG; SLC25A24: forward primer, ATGC­AGGCTCAAGCCATGT, reverse primer, GCCTCTGTAAAGTCCTGGTA, and probe, TCCAAAGAAGGAATACC; and SLC25A25: forward primer, TGGAAGCATTCCACGATCT, reverse primer, TGAACTCATCCGGGACCGTTA, and probe, ATGTGGG­TGAG­AATCTA). The relative gene expression was calibrated with WT type using 7300 Real Time PCR system RQ study software (Applied Biosystems, Carlsbad, CA).

Cytosolic and mitochondrial Ca²⁺ dynamics

HeLa cells were grown on 25-mm glass coverslips for 48 h and loaded with 2 μM Rhod-2 AM (50 min) and 5 μM Fluo-4 AM (30 min) (Life Technologies) in extracellular medium (Madesh et al., 2005; Mallilankaraman et al., 2012a). After 1 min of baseline recording, agonist (histamine, 100 μM) was added, and confocal images were recorded every 3 s (510 Meta; Carl Zeiss, Thornwood, NY) at 488- and 561-nm excitation using a 63× oil objective to simultaneously monitor cytoplasmic and mitochondrial Ca²⁺ dynamics. Images were analyzed and quantified using ImageJ (National Institutes of Health, Bethesda, MD) and custom-made software (Spectralyzer, Elmsford, NY).

Assessment of mitochondrial Ca²⁺ influx and efflux rates

HeLa cells were permeabilized and loaded with the ratiometric Ca²⁺ indicator Fura2-FF. Cells were pulsed with 10 μM Ca²⁺ at 350 s to measure mitochondrial Ca²⁺ uptake, followed by addition of 1 μM Ru360 at 550 s, 10 μM CGP37157 at 610 s, and 2 μM CCCP at 750 s.

Coimmunoprecipitation assay

Cell extracts were prepared from either stably or transiently transfected COS-7 cells using RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.25% deoxycholic acid, 1 mM EDTA, 1% NP-40, protease inhibitor cocktail [Complete; Roche, Indianapolis, IN], and 1 mM phenylmethylsulfonyl fluoride). To study the interaction of MCU with SLC25A23, we used GFP-tagged MCU and Flag-tagged SLC25A23. Flag-tagged MICU1 was used as a positive control (Hoffman et al., 2013). Stably MCU-GFP–expressing COS7 cells were transfected with Flag-tagged, full-length MICU1 or SLC25A23. Similarly for understanding the interaction of SLC25A23 with MICU1, stably MICU1-HA–expressing COS7 cells were transfected with Flag-tagged SLC25A23. After immunoprecipitation with anti-GFP (Evrogen, Moscow, Russia) or anti-HA (Thermo Scientific, Waltham, MA) antibody, total cell lysates and immunoprecipitated materials were subjected to Western blot analysis. Ten percent of cell lysates were probed with anti-Flag (Sigma-Aldrich, St. Louis, MO), anti-GFP or anti-HA antibodies to serve as inputs, and similarly, immunoprecipitated samples were probed with their corresponding antibodies.

I_MCU recording

Mitoplast patch clamp recordings were conducted at 30°C as previously described (Kirichok et al., 2004; Hoffman et al., 2013). I_MCU was recorded using a computer-controlled Axon200B patch-clamp amplifier with a Digidata 1320A acquisition board (pClamp 10.0 software; Axon Instruments, Sunnyvale, CA). Mitoplasts were bathed in CaCl₂ (5 mM) ± P_i (300 μM), sodium gluconate (150 mM), KCl (5.4 mM), and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; 10 mM), pH 7.2. The pipette solution contained sodium gluconate (150 mM), NaCl (5 mM), sucrose (135 mM), HEPES (10 mM), and EGTA (1.5 mM), pH 7.2. After formation of GΩ seals (pipette resistance, 15–25 MΩ), the mitoplasts were ruptured with 200- to 400-mV pulses varying from 2- to 6-ms duration. Mitoplast capacitance was measured (2.2–3.8 pF). After capacitance compensation, mitoplasts were held at 0 mV, and I_MCU was elicited with a voltage ramp (from −160 to 80 mV, 120 mV/s).

Oxygen consumption rate

HeLa cells (1 × 10⁶) were permeabilized with 20 μg/ml digitonin in 140 μl of intracellular medium (120 mM KCl, 10 mM NaCl, 1 mM KH₂PO₄, 20 mM HEPES–Tris, pH 7.2), and oxygen consumption rate was measured using a MT200A MitoCell Clark-type electrode and MT200A MitoCell chamber (Strathkelvin Instruments, Motherwell, United Kingdom) during constant stirring (Irrinki et al., 2011). Next, in 1-min intervals, 5 mM complex I substrates malate/pyruvate, 100 nM complex I inhibitor rotenone, 5 mM complex II substrate succinate, 50 nM complex II inhibitor antimycin A, 0.4 mM complex V substrates tetramethylphenylenediamine/2.5 mM ascorbate, and 1 μM complex IV inhibitor sodium azide were added (Irrinki et al., 2011).

NAD(P)H autofluorescence measurement

NAD(P)H autofluorescence was measured through the change in autofluorescence of NAD(P)H at 350/460 nm (excitation/emission) with a multiwavelength-excitation, dual-wavelength-emission fluorimeter (Delta RAM; PTI, Birmingham, NJ; Jones et al., 2007). Briefly, cells (8 × 10⁶ cells) were suspended in Hank's balanced salt solution (Sigma-Aldrich) and permeabilized with digitonin (Hawkins et al., 2010b). NAD(P)H levels were monitored before and after 10 μM rotenone.

Confocal ΔΨ_m measurement

HeLa cells were plated in six-well plates containing 0.2% gelatin–coated glass coverslips (Thapa et al., 2011), and 100 nM TMRE perchlorate was added to cells and incubated for 30 min at 37°C. Nuclear DNA stain, 2-(4-ethoxyphenyl)-6-[6-(4-methylpiperazin-1-yl)-1H-benzimidazol-2-yl]-1H-benzimidazole (Hoescht 33342), was added for 5 min. Image acquisition was performed using a Carl Zeiss 510 confocal microscope using a 63× oil objective with excitation at 561 and 405 nm, respectively. Images were quantified using ImageJ (Madesh et al., 2005).

Mitochondrial ROS measurement

HeLa cells were loaded with the mitochondrial superoxide–sensitive fluorophore MitoSOX Red (Life Technologies; 10 μM) in extracellular matrix (ECM) containing 2% bovine serum albumin (BSA) at 37°C for 10 min. Cells were incubated with Hoescht 33342 for an additional 5 min at room temperature. Cells were then washed, resuspended in ECM containing 0.2% BSA, and imaged using a Carl Zeiss 710 two-photon confocal microscope with a 20× liquid immersion objective at 405 and 561 nm for Hoescht 33342 and MitoSOX Red, respectively (Robinson et al., 2006; Mukhopadhyay et al., 2007).

Mitochondrial DNA content measurement

HeLa cells were transiently transfected with the mitochondrial marker monomeric yellow fluorescent protein plasmid construct. After 48 h, cells were fixed and stained for mitochondrial DNA using monoclonal anti-DNA antibody conjugated with secondary goat anti-mouse immunoglobulin M–Alexa Fluor 594 (Life Technologies). Slides were mounted using ProLong Gold Antifade reagent (Molecular Probes). Images were acquired using a Carl Zeiss 710 two-photon confocal microscope with a 63× oil objective. mtDNA was quantified using ImageJ software.

ATP measurement

ATP levels were measured using the CellTiter-Glo Luminescent Cell Viability Assay (Promega, Madison, WI) as per the manufacturer's instructions. ATP levels (luminescence) were measured in a model 96F nontreated white microwell plate (Nunc, Rochester, NY) using a Victor X5 2030 multilabel reader (Perkin Elmer, Waltham, MA; Irrinki et al., 2011). To verify loading quantity, a Bradford assay was performed.

Assessment of cell death

HeLa cells were challenged with t-butyl hydroperoxide (200 μM). After treatment, the cells were labeled with annexin V–Alexa 405 conjugate for 25 min with annexin binding buffer (Molecular Probes, Life Technologies). During annexin V binding, propidium iodide (0.5 μg/ml) was also loaded to visualize plasma membrane integrity. Cell death was monitored using a Carl Zeiss 510 Meta confocal imaging system (Madesh et al., 2002, 2005, 2009).

Statistical analysis

All experiments were performed three or more times. Data from multiple experiments were quantified and are expressed as mean ± SEM, and differences between groups were analyzed by using a two-tailed Student's t test. p < 0.05 was considered significant in all analyses. Data were plotted with either GraphPad Prism (La Jolla, CA), version 5.0, or SigmaPlot 11.0 software.