Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Sep 11.
Published in final edited form as: Prostate. 2009 May 1;69(6):603–609. doi: 10.1002/pros.20910

Shared P53 Gene Mutation in Morphologically and Phenotypically Distinct Concurrent Primary Small Cell Neuroendocrine Carcinoma and Adenocarcinoma of the Prostate

Donna E Hansel 1, Masashi Nakayama 2, Jun Luo 3, Abde M Abukhdeir 4, Ben H Park 4, Charles J Bieberich 5, Jessica L Hicks 6, Mario Eisenberger 3,4, William G Nelson 3,4, Jasek L Mostwin 3, Angelo M De Marzo 3,6
PMCID: PMC3170854  NIHMSID: NIHMS285484  PMID: 19125417

Abstract

Background

Small cell carcinoma of the prostate is an uncommon neoplasm, the origin of which has been controversial. To address this, we performed transcriptome profiling and TP53 sequencing of concurrent small cell and prostatic adenocarcinoma to determine the relationship between these entities.

Methods

We identified an unusual case of primary prostate cancer that contained adjacent acinar adenocarcinoma (Gleason score 4+3=7) and small cell carcinoma. We performed laser capture microdissection to isolate tumor components and performed gene expression and TP53 gene sequence analysis on each component, with results validated by immunohistochemistry for PSA, PSAP, PSMA, androgen receptor, NKX 3.1 and neuroendocrine markers.

Results

Transcriptome profiling of the carcinoma components identified 99 genes with a greater than 10-fold differential expression between prostatic adenocarcinoma and small cell carcinoma, many of which have not been previously reported in prostate cancer. The small cell carcinoma component demonstrated upregulation of proliferative and neuroendocrine markers and tyrosine kinase receptors, and downregulation of cell adhesion molecules, supporting the aggressive nature of this form of carcinoma. Sequencing of the TP53 gene suggested a common clonal origin for both components.

Conclusions

This is the first report of a primary small cell carcinoma of the prostate subjected to extensive molecular analysis and the first to show a clonal relation between two morphologically distinct prostate cancer types. The evidence of progression to small cell carcinoma may yield important insights into the pathogenesis of this entity and provide a novel spectrum of molecular markers to further dissect cellular pathways important in tumor progression.

Keywords: carcinoma, small cell, prostate, genes, p53, DNA sequence

Introduction

Prostate cancer is the most common non-cutaneous cancer and the second leading cause of cancer deaths in males in the United States. The vast majority of prostate cancers consist of adenocarcinoma. Although the majority of adenocarcinomas of the prostate contain some neoplastic neuroendocrine cells27, small cell carcinoma is rare and reflects less than 0.1% of all primary prostate cancers8. Most commonly, prostatic small cell carcinoma appears in the context of metastatic conventional adenocarcinoma in patients treated with androgen deprivation therapy5,8,24, and such patients demonstrate rapid progression of disease with death often occurring within 1 year of diagnosis8,24,27.

We describe a patient with a combination of primary acinar adenocarcinoma and small cell carcinoma within adjacent regions of the prostate identified at radical prostatectomy following a prior prostate needle biopsy diagnosis of conventional acinar adenocarcinoma. To gain insights into the pathobiology of this disease we performed extensive molecular analyses (e.g. transcriptome profiling and P53 gene sequencing) of separately isolated tumor components.

Patients and Methods

Patient History

A 55 year old Caucasian male patient presented with progressively elevated serum prostate specific antigen (PSA). Two years prior to admission, the patient’s PSA was 3.5 ng/ml, which increased to 5.5 ng/ml one year prior to admission. Digital rectal examination revealed abnormalities of both sides of the prostate. Needle biopsies of the prostate identified a Gleason score 4+3 = 7 acinar adenocarcinoma in the left portion of the gland, which involved three of multiple cores. The patient underwent a bone scan and computed tomography of the abdomen and pelvis, which revealed no evidence of metastasis.

Five months following biopsy diagnosis, the patient’s PSA was 4.9 ng/ml with a 14% free fraction. Radical prostatectomy with bilateral pelvic lymph node dissection was performed without complications. Pathologic analysis of the fully sampled prostate identified acinar adenocarcinoma (Gleason score 4+3=7), and adjacent areas with histological features of small cell carcinoma, with some larger neuroendocrine carcinoma cells mixed in (Fig. 1–2). The tumor extensively involved the left lateral, posterolateral, and posterior apical to mid portions of the gland. Focal extraprostatic extension and positive margins were identified on the posterolateral left aspect of the gland. No invasion of the seminal vesicles was noted and the pelvic lymph nodes and excised neurovascular tissue were negative for tumor.

Figure 1. Histopathological Findings.

Figure 1

Open in a new tab

A, Low power view of region of typical gland forming Gleason patterns 3 and 4 acinar adenocarcinoma on the left and non-gland forming small cell neuroendocrine carcinoma on the right. B, Medium power view shows well-formed and well-spaced glands diagnostic of Gleason pattern 3 adenocarcinoma. Note mucin in some glands. Carcinoma cells show round nuclei and prominent nucleoli. Similar nuclear morphology was in Gleason pattern 4 component (not shown). The right shows sheets of cells without gland formation. The cells are hyperchromatic with marked nuclear pleomorphism, but no clear nucleoli. C, Higher power view of neuroendocrine component showing nuclear pleomorphism and nuclear molding, finely dispersed chromatin, lack of nucleoli and mitotic activity. In this region, some of the NE tumor cells show abundant cytoplasm. D, Low power view of staining for neuroendocrine marker, CD56, shows clear dichotomy of phenotype corresponding to H&E features. E, Another area of neuroendocrine component of the tumor showing prominent “small cell” features with little cytoplasm. F, Higher power view of adenocarcinoma component showing glands, round nuclei and prominent nucleoli.

Figure 2. Immunophenotypic Features.

Figure 2

Open in a new tab

A, Low/medium power view of H&E stained section show both acinar adenocarcinoma and small cell neuroendocrine carcinoma morphologies. B–E, Higher power view showing PSA, PSAP, Androgen receptor (AR), and PSMA stain only the adenocarcinoma component. F, chromogranin staining is restricted to the small cell component. G, Ki-67 stain shows markedly increased proliferative fraction in small cell component. H, p53 staining shows that both adenocarcinoma and small cell carcinoma component of the tumor stain strongly, suggesting a p53 mutation in both.

Postoperatively, the patient was treated with a combination of androgen deprivation treatment and various chemotherapy regimens usually employed for other small cell carcinomas. However, over the next 2 years he developed rapidly progressing visceral and bone metastasis and ultimately succumbed to metastatic carcinoma approximately 2 years after prostatectomy. Although the histology of the metastatic disease was not verified, the rapidly fatal course, the pattern of metastatic disease (visceral), lack of PSA elevation and responsiveness to androgen deprivation support that death resulted from the highly aggressive small cell carcinoma component.

Immunohistochemical analysis

Tissue sections containing both tumor components and were immunolabeled with prostate specific antigen (PSA, DAKO [Carpentaria, CA], ER-PR8, 1:500), prostate specific acid phosphatase (PSAP, DAKO 1:500), AMACR/P504S (Zeta Corp [Sierra Madre, CA], 1:80), neuron-specific enolase (Ventana [Tucson, AZ], BBS/NC/VIh, 1:2000), androgen receptor (Santa Cruz, [Santa Cruz CA], 1:250), p53 (DAKO*, D07, 1:800), Ki-67 (Zymed/Invitrogen [Carlsbad, California], 1:400), prostate specific membrane antigen (7E11, 1:500), and NKX3.1 (rabbit polyclonal2, 1:1000), CD56 (Zymed, 123C3, 1:200), synaptophysin (Ventana, 1:100), chromogranin (Chemicon/Millipore [Billerica, MA], LK2H10, 1:3200). All stains (except NSE and synaptophysin) were performed with the Envision+ system from DAKO with citrate steam pretreatment. Stains for synaptophysin and NSE were performed using the Ventana Benchmark® XT automated staining system.

Transcriptome Profiling

Laser Capture Microdissection of acinar adenocarcinoma and small cell carcinoma components was performed using the PixCell II from Arcturus (Molecular Devices, Sunnyvale, CA) using frozen tissue. RNA extraction, cDNA synthesis, labeling, hybridization and analysis were carried out as previously described17,18.

Genomic DNA sequencing of TP53

Genomic DNA was also isolated after laser capture microdissection of separate acinar and neuroendocrine components from frozen sections and used for PCR and direct sequencing as previously described14. For the relevant mutation, exons 5 and 6 of the human p53 gene were PCR amplified as a single amplicon with Platinum Taq polymerase (Invitrogen). The forward and reverse primers used for PCR were 5′-ggttgcaggaggtgcttacg-3′ and 5′-cactgacaaccacccttaac-3′, respectively. PCR products were purified and directly sequenced via automated fluorescence sequencing. Exon 5 was sequenced using the reverse primer 5′cactcggataagatgctgag3′, while exon 6 was sequenced using the forward primer 5′atggccatctacaagcagtc3′.

Results

Routine staining of the different tumor components is shown in Figure 1. The small cell carcinoma contained tumor cells that were growing in sheets and nests. The nuclei in this component were hyperchromatic, pleomorphic, and contained finely granulated chromatin, lacking visible nucleoli. Unlike the adenocarcinoma component, the small cell carcinoma component demonstrated numerous mitotic figures and apoptotic bodies. Intimately admixed with this component were areas containing cells with similar nuclear features and high mitotic rate, but which had much more cytoplasm. These areas, which tended to be arranged in nests and acinar-like structures, were still considered part of the small cell component, as their nuclear features resembled the smaller neuroendocrine cells, not showing the enlarged nucleoli seen in large cell neuroendocrine carcinomas7. The acinar component, which was largely separate from but adjacent to the neuroendocrine components, showed glandular differentiation with areas of Gleason pattern 3 and areas with cribriforming Gleason pattern 4.

The acinar adenocarcinoma component demonstrated robust labeling (at least 90% of cells staining strongly positive) for PSA, PSAP, androgen receptor, NKX 3.12 (not shown) and prostate specific membrane antigen (PSMA; Figure 2). The adenocarcinoma component was positive for p53 (Figure 2) and racemase (not shown), but negative for the neuroendocrine markers chromogranin, synaptophysin, CD56 and neuron-specific enolase. In contrast, the small cell carcinoma component demonstrated robust immunoreactivity for chromogranin A (Figure 2), neuron-specific enolase (not shown), synaptophysin (not shown), and CD56 (see Figure 1) but negative immunoreactivity for PSA, PSAP (Figure 2), and NKX 3.1 (not shown). Staining for the androgen receptor was largely negative in the small cell component (Figure 2). Staining for Ki-67 showed a marked increase in the proliferation index in the small cell neuroendocrine component (Figure 2).

RNA was separately isolated from the 2 components by laser capture microdissection and used for cDNA expression array analysis, which revealed strikingly distinct profiles. Table 1 shows a list of genes that showed a 10 fold or greater difference in levels of expression between the two components. There was an up-regulation of 57 genes within the small cell component. Highly overexpressed genes in the small cell component included two different neurofilament encoding genes, as well as chromogranin C and chromogranin A, (Table 1). There was also upregulation of CTNNA2 in the small cell component, which encodes the alpha 2 catenin protein, the expression of which is largely restricted to the brain9,13. Another gene up-regulated in the small cell neuroendocrine component was FGFR3, which encodes a tyrosine kinase receptor that is highly expressed in brain and several other tissues.

Table 1. Differentially Expressed Genes in Small Cell/Neuroendocrine Cancer Versus Acinar Adenocarcinoma*.

Genes showing 10 fold or greater differential expression between the acinar and small cell carcinoma components.

Tag Gene Small cell Acinar
Hs.150917 Catenin 1.1885 0.0324
Hs.172216 Chromogranin A 0.3744 0.0223
Hs.75426 Chromogranin C 1.3466 0.0405
Hs.1420 Fibroblast growth factor receptor 3 2.9414 0.2747
Hs.1472 Gastrin-releasing peptide 0.7807 0.0233
Hs.57771 Kallikrein 11 50.6092 4.9079
Hs.79070 MYC oncogene 1.1200 0.0923
Hs.268490 Nuclear receptor subfamily 0, group B, member 1 0.4756 0.0363
Hs.104741 PDZ-binding kinase 0.9702 0.0823
Hs.156346 Topoisomerase (DNA) II alpha (170 kD) 0.6487 0.0623
Hs.26126 Claudin 10 0.0934 2.8528
Hs.169825 Collagen, type IV, alpha 5 0.2752 9.9135
Hs.8867 Cysteine-rich, angiogenic inducer, 61 3.3769 38.6053
Hs.49585 Fibroblast growth factor 18 0.1928 2.8263
Hs.77348 Hydroxyprostaglandin dehydrogenase 15-(NAD) 0.4025 7.1171
Hs.2256 Matrix metalloproteinase 7 0.4891 6.3144
Hs.790 Microsomal glutathione S-transferase 1 5.1699 78.8289
Hs.198267 Mucin 4, tracheobronchial 0.3112 3.8792
Hs.313 Osteopontin 0.313 6.1868
Hs.105700 Secreted frizzled-related protein 4 0.3755 7.3453
Open in a new tab
*

Expression levels are standardized against BPH tissue

Upregulation of a number of proliferation associated markers was apparent in the small cell carcinoma component, which correlates with the increased proliferation index. PDZ-binding kinase (PBK/TOPK), which undergoes mitosis specific phosphorylation, is expressed in a variety of proliferative cell types including male germ line progenitor cells, activated T-cells and a variety of lymphomas and leukemias, but is not present in all proliferating cells1,23. PBK/TOPK has also been demonstrated in specific neural progenitor cells in vivo,6 and is found to be upregulated in hormone refractory metastatic prostate carcinoma as seen by querying the Oncomine™ database20,26. Upregulation of the C-MYC oncogene has been reported in many carcinoma types, including prostate carcinoma19, and amplification of chromosome 8q24 in the region encoding C-MYC correlates with a worse prognosis in prostate cancer11,21.

Downregulation of 42 genes within the small cell carcinoma component was identified. These included CLDN10, which encodes the claudin 10 gene, which is an important structural component of tight junctions, and COL4A5, which encodes collagen type IV, which is specific for basement membranes. CYR61 (encoding cysteine-rich, angiogenic inducer, 61) was consistently seen to be down regulated in 6 different studies of metastatic and hormone refractory prostate cancer, as compared to primary prostate cancer4,10,16,20,25,26,28. MMP7, encoding matrix metalloproteinase 7, was down regulated in the small cell carcinoma component and this gene is also seen to be down regulated in 3 different metastatic prostate cancer datasets in the Oncomine™ database (1 hormone naïve and 2 hormone refractory) 4,15,20,26.

After finding positive staining in both components for p53, we subsequently performed genomic DNA sequencing of the TP53 gene. Both the acinar and small cell/neuroendocrine components showed an identical mutation in the DNA binding domain (R175H) of TP53 (Figure 3), albeit with the acinar component apparently retaining the wild-type allele but the small cell component showing a homozygous mutant form. Neither the normal microdissected epithelium, nor the frozen seminal vesicle tissue from the patient showed a TP53 mutation confirming that this mutation was somatic.

Figure 3. Common R175H Mutation Of TP53 Gene In Both Tumor Components with Retention of Wild-Type Allele in Adenocarcinoma.

Figure 3

Open in a new tab

Discussion

Although we have utilized only a single case, our differential gene expression data appears robust, given the fact that genes known to be highly expressed in neuroendocrine cells were markedly upregulated in that component. A number of the genes we identified to be upregulated in the neuroendocrine component (CTNNA2, FGFR3, FGF12, and NR0B1) have not been previously reported to be altered in transcriptome profiling or other studies in prostate cancer20, although our study has focused on comparing gene profiles between admixed acinar adenocarcinoma and small cell carcinoma components, rather than between these entities and benign prostatic epithelium. Similarly, CLDN10 has not previously been identified as being decreased in prostate cancer20. Additional studies to validate these finding in a larger series of small cell carcinomas of the prostate are warranted.

Other genes shown to be upregulated in the small cell carcinoma component have been shown to be upregulated previously in hormone refractory metastatic prostate carcinoma including PBK, and TOP2A, and, one other gene that was downregulated in the small cell carcinoma was also found to be down regulated in hormone refractory metatastic prostate cancer (CYR61). Since our case was a primary carcinoma in a patient untreated with androgen deprivation, these findings suggest that these genes may be associated with aggressive prostate cancer and not simply with hormonal withdrawal.

A prior study of differential gene expression had been performed using RNA isolated from the prostatic small cell carcinoma xenograft LuCaP 493. When compared with our results, two upregulated genes in small cell carcinoma were shared and included ALL1 fused gene from chromosome 1q (AF1Q) and internexin neuronal intermediate filament protein, alpha (INA). Another study of hormone refractory metastatic prostate carcinoma performed transcriptome profiling of 2 cases of small cell carcinoma22, albeit there was little overlap between their top overexpressed or underexpressed genes and those in the present study.

The shared p53 mutation identified by gene sequencing supports a derivation from a common clone of the acinar adenocarcinoma and small cell carcinoma components of this tumor. If these tumors are indeed derived from the same clone, this can be explained either by tumor progression in which there was “transdifferentiation” of one partially differentiated tumor cell type to another, or, by a preexisting common “cancer stem cell” that gave rise to at least two distinct progeny that in turn gave rise to each distinct component8.

Although we cannot fully rule out stromal contamination from the acinar component, the small cell component did appear to lose the wild-type p53 allele compared to the acinar component (Figure 3), which is consistent with a stepwise progression to the neuroendocrine phenotype. A prior study of colitis-associated colorectal cancer uncovered a stepwise molecular progression event in which the dysplasia (in situ component) contained one mutated p53 allele, and the adjacent invasive carcinoma component showed this mutation and a second different mutation in the other TP53 allele12.

In summary we performed the first extensive molecular analysis (e.g. transcriptome profiling and P53 gene sequencing) of separately isolated de novo primary prostatic acinar and neuroendocrine carcinoma. Both components shared the same TP53 mutation, providing strong evidence that both were derived from the same clone. Yet, there appeared to be a molecular progression of disease such that the adenocarcinoma component retained a wildtype TP53 allele, yet the small cell carcinoma component lost the wild type allele. In addition, several of the genes found to be differentially expressed in the small cell component have been previously associated with hormone refractory metastatic adenocarcinoma. Since the present patient was not treated with hormonal therapy at the time of prostatectomy, these gene alterations were not simply due to hormonal treatment, but may be related to progression of prostate cancer.

Acknowledgments

The authors would like to thank Jonathan I. Epstein MD for reviewing the histopathology slides on this case.

References

  • 1.Abe Y, Matsumoto S, Kito K, Ueda N. Cloning and expression of a novel MAPKK-like protein kinase, lymphokine-activated killer T-cell-originated protein kinase, specifically expressed in the testis and activated lymphoid cells. J Biol Chem. 2000;275:21525–21531. doi: 10.1074/jbc.M909629199. [DOI] [PubMed] [Google Scholar]
  • 2.Bethel CR, Faith D, Li X, Guan B, Hicks JL, Lan F, Jenkins RB, Bieberich CJ, De Marzo AM. Decreased NKX3.1 protein expression in focal prostatic atrophy, prostatic intraepithelial neoplasia and adenocarcinoma: association with Gleason score and chromosome 8p deletion. Cancer Res. 2006;66:10683–10690. doi: 10.1158/0008-5472.CAN-06-0963. [DOI] [PubMed] [Google Scholar]
  • 3.Clegg N, Ferguson C, True LD, Arnold H, Moorman A, Quinn JE, Vessella RL, Nelson PS. Molecular characterization of prostatic small-cell neuroendocrine carcinoma. Prostate. 2003;55:55–64. doi: 10.1002/pros.10217. [DOI] [PubMed] [Google Scholar]
  • 4.Dhanasekaran SM, Dash A, Yu J, Maine IP, Laxman B, Tomlins SA, Creighton CJ, Menon A, Rubin MA, Chinnaiyan AM. Molecular profiling of human prostate tissues: insights into gene expression patterns of prostate development during puberty. Faseb J. 2005;19:243–245. doi: 10.1096/fj.04-2415fje. [DOI] [PubMed] [Google Scholar]
  • 5.di Sant’ Agnese PA, Egevad L, Epstein JI, Helpap B, Humphrey PA, Montironi R, Rubin MA, Sakr WA, Tan PH. Neuroendocrine tumors. In: Eble JN, Sauter G, Epstein JI, Sesterhenn IA, editors. World health organization classification of tumors, pathology & genetics: Tumors of the urinary system and male genital organs. Lyon: IARC Press; 2004. pp. 207–208. [Google Scholar]
  • 6.Dougherty JD, Garcia AD, Nakano I, Livingstone M, Norris B, Polakiewicz R, Wexler EM, Sofroniew MV, Kornblum HI, Geschwind DH. PBK/TOPK, a proliferating neural progenitor-specific mitogen-activated protein kinase kinase. J Neurosci. 2005;25:10773–10785. doi: 10.1523/JNEUROSCI.3207-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Evans AJ, Humphrey PA, Belani J, van der Kwast TH, Srigley JR. Large cell neuroendocrine carcinoma of prostate: a clinicopathologic summary of 7 cases of a rare manifestation of advanced prostate cancer. Am J Surg Pathol. 2006;30:684–693. doi: 10.1097/00000478-200606000-00003. [DOI] [PubMed] [Google Scholar]
  • 8.Helpap B, Kollermann J, Oehler U. Neuroendocrine differentiation in prostatic carcinomas: histogenesis, biology, clinical relevance, and future therapeutical perspectives. Urol Int. 1999;62:133–138. doi: 10.1159/000030376. [DOI] [PubMed] [Google Scholar]
  • 9.Hirano S, Kimoto N, Shimoyama Y, Hirohashi S, Takeichi M. Identification of a neural alpha-catenin as a key regulator of cadherin function and multicellular organization. Cell. 1992;70:293–301. doi: 10.1016/0092-8674(92)90103-j. [DOI] [PubMed] [Google Scholar]
  • 10.Holzbeierlein J, Lal P, LaTulippe E, Smith A, Satagopan J, Zhang L, Ryan C, Smith S, Scher H, Scardino P, Reuter V, Gerald WL. Gene expression analysis of human prostate carcinoma during hormonal therapy identifies androgen-responsive genes and mechanisms of therapy resistance. Am J Pathol. 2004;164:217–227. doi: 10.1016/S0002-9440(10)63112-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jenkins RB, Qian J, Lieber MM, Bostwick DG. Detection of c-myc oncogene amplification and chromosomal anomalies in metastatic prostatic carcinoma by fluorescence in situ hybridization. Cancer Res. 1997;57:524–531. [PubMed] [Google Scholar]
  • 12.Kern SE, Redston M, Seymour AB, Caldas C, Powell SM, Kornacki S, Kinzler KW. Molecular genetic profiles of colitis-associated neoplasms. Gastroenterology. 1994;107:420–428. doi: 10.1016/0016-5085(94)90167-8. [DOI] [PubMed] [Google Scholar]
  • 13.Kobielak A, Fuchs E. Alpha-catenin: at the junction of intercellular adhesion and actin dynamics. Nat Rev Mol Cell Biol. 2004;5:614–625. doi: 10.1038/nrm1433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Konishi H, Karakas B, Abukhdeir A, Lauring J, Gustin JP, Garay JP, Konishi Y, Gallmeier E, Bachman KE, Park BH. Knock-in of mutant K-ras in nontumorigenic human epithelial cells as a new model for studying K-ras mediated transformation. Cancer Res. 2007;67:8460–8467. doi: 10.1158/0008-5472.CAN-07-0108. [DOI] [PubMed] [Google Scholar]
  • 15.Lapointe J, Li C, Higgins JP, van de Rijn M, Bair E, Montgomery K, Ferrari M, Egevad L, Rayford W, Bergerheim U, Ekman P, DeMarzo AM, Tibshirani R, Botstein D, Brown PO, Brooks JD, Pollack JR. Gene expression profiling identifies clinically relevant subtypes of prostate cancer. Proc Natl Acad Sci U S A. 2004;101:811–816. doi: 10.1073/pnas.0304146101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.LaTulippe E, Satagopan J, Smith A, Scher H, Scardino P, Reuter V, Gerald WL. Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease. Cancer Res. 2002;62:4499–4506. [PubMed] [Google Scholar]
  • 17.Luo J, Duggan DJ, Chen Y, Sauvageot J, Ewing CM, Bittner ML, Trent JM, Isaacs WB. Human prostate cancer and benign prostatic hyperplasia: molecular dissection by gene expression profiling. Cancer Res. 2001;61:4683–4688. [PubMed] [Google Scholar]
  • 18.Luo J, Dunn T, Ewing C, Sauvageot J, Chen Y, Trent J, Isaacs W. Gene expression signature of benign prostatic hyperplasia revealed by cDNA microarray analysis. Prostate. 2002;51:189–200. doi: 10.1002/pros.10087. [DOI] [PubMed] [Google Scholar]
  • 19.Meng MV, Dahiya R. Molecular genetics of prostate cancer. In: Carroll PR, Grossfeld GD, editors. Prostate Cancer. BC Decker Inc; 2002. [Google Scholar]
  • 20.Rhodes DR, Kalyana-Sundaram S, Mahavisno V, Varambally R, Yu J, Briggs BB, Barrette TR, Anstet MJ, Kincead-Beal C, Kulkarni P, Varambally S, Ghosh D, Chinnaiyan AM. Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia. 2007;9:166–180. doi: 10.1593/neo.07112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sato K, Qian J, Slezak JM, Lieber MM, Bostwick DG, Bergstralh EJ, Jenkins RB. Clinical significance of alterations of chromosome 8 in high-grade, advanced, nonmetastatic prostate carcinoma. J Natl Cancer Inst. 1999;91:1574–1580. doi: 10.1093/jnci/91.18.1574. [DOI] [PubMed] [Google Scholar]
  • 22.Shah RB, Mehra R, Chinnaiyan AM, Shen R, Ghosh D, Zhou M, Macvicar GR, Varambally S, Harwood J, Bismar TA, Kim R, Rubin MA, Pienta KJ. Androgen-independent prostate cancer is a heterogeneous group of diseases: lessons from a rapid autopsy program. Cancer Res. 2004;64:9209–9216. doi: 10.1158/0008-5472.CAN-04-2442. [DOI] [PubMed] [Google Scholar]
  • 23.Simons-Evelyn M, Bailey-Dell K, Toretsky JA, Ross DD, Fenton R, Kalvakolanu D, Rapoport AP. PBK/TOPK is a novel mitotic kinase which is upregulated in Burkitt’s lymphoma and other highly proliferative malignant cells. Blood Cells Mol Dis. 2001;27:825–829. doi: 10.1006/bcmd.2001.0452. [DOI] [PubMed] [Google Scholar]
  • 24.Tetu B, Ro JY, Ayala AG, Johnson DE, Logothetis CJ, Ordonez NG. Small cell carcinoma of the prostate. Part I. A clinicopathologic study of 20 cases. Cancer. 1987;59:1803–1809. doi: 10.1002/1097-0142(19870515)59:10<1803::aid-cncr2820591019>3.0.co;2-x. [DOI] [PubMed] [Google Scholar]
  • 25.Tomlins SA, Mehra R, Rhodes DR, Cao X, Wang L, Dhanasekaran SM, Kalyana-Sundaram S, Wei JT, Rubin MA, Pienta KJ, Shah RB, Chinnaiyan AM. Integrative molecular concept modeling of prostate cancer progression. Nat Genet. 2007;39:41–51. doi: 10.1038/ng1935. [DOI] [PubMed] [Google Scholar]
  • 26.Varambally S, Yu J, Laxman B, Rhodes DR, Mehra R, Tomlins SA, Shah RB, Chandran U, Monzon FA, Becich MJ, Wei JT, Pienta KJ, Ghosh D, Rubin MA, Chinnaiyan AM. Integrative genomic and proteomic analysis of prostate cancer reveals signatures of metastatic progression. Cancer Cell. 2005;8:393–406. doi: 10.1016/j.ccr.2005.10.001. [DOI] [PubMed] [Google Scholar]
  • 27.Vashchenko N, Abrahamsson PA. Neuroendocrine differentiation in prostate cancer: implications for new treatment modalities. Eur Urol. 2005;47:147–155. doi: 10.1016/j.eururo.2004.09.007. [DOI] [PubMed] [Google Scholar]
  • 28.Yu YP, Landsittel D, Jing L, Nelson J, Ren B, Liu L, McDonald C, Thomas R, Dhir R, Finkelstein S, Michalopoulos G, Becich M, Luo JH. Gene expression alterations in prostate cancer predicting tumor aggression and preceding development of malignancy. J Clin Oncol. 2004;22:2790–2799. doi: 10.1200/JCO.2004.05.158. [DOI] [PubMed] [Google Scholar]

RESOURCES