Crohn’s Disease-Associated Nod2 Mutation Limits Production of Pro-Inflammatory Cytokines to Protect the Host from Enterococcus faecalis-Induced Lethality¹

Mice

C57BL/6 mice were raised in our animal facility from breeders originally purchased from Jackson Laboratories (Bar Harbor, ME). Nod2^−/− miceona C57BL/6 background have been reported (10). The construction of Nod2 Leu980fs–knock-in mice was described (11). Homozygous Nod2 Leu980fs–knock-in (Nod2^m/m) mice and heterozygous Nod2^+/m littermates on a mixed 129–C57BL/6 background were backcrossed six times to C57BL/6 mice before used for in vivo experiments. Control wild-type mice were derived from crosses between heterozygous Nod2^+/mmice backcrossed six times to C57BL/6 mice. The animal studies were conducted under approved protocols by the University of Michigan Committee on Use and Care of Animals.

Macrophage stimulation and infection

Bone-marrow derived macrophages (BMDM) were prepared as previously described (12). Lipoteichoic acid (LTA) was from Invivogen and MDP from Bachem. E. faecalis strain OG1RF (ATCC 47077) was from the American Type Culture Collection. Macrophages were infected with bacteria for 60 min at 37° C, washed twice with PBS and IMDM containing 50 μg/ml of gentamycin to limit the growth of extracellular bacteria.

HEK293T Bioassay for Nod1 and Nod2 Stimulation

Nod1 and Nod2-stimulatory was determined as previously reported (16).

Measurement of cytokines

Mouse cytokines were measured using enzyme-linked immunoabsorbent assay (ELISA) kits from R&D Systems.

Immunoblotting

Immunoblotting for mouse IκB-α, phospho-IκB-α, p38 and phospho-p38, phospho-ERK, and phospho-JNK (Cell Signaling Technology, Beverly, MA) was performed as described (10). To detect Nod2, protein extracts from mouse small intestines were immunoprecipitated using a rabbit polyclonal anti-Nod2 antibody (13), followed by immunoblotting with anti-Nod2 monoclonal antibody (13). Binding was revealed by enhanced chemiluminescence (Pierce).

Nod2 knock-in cDNA Sequencing

Total RNA extracted from BMDM was reverse transcribed and the resulting cDNA was applied as template for PCR with primers spanning Nod2 2939^insC mutation (Forward: TTGAGTGTGCTCTTCGCTGT; Reverse: ACCAACCATCACGACTCCTC). Amplified products were purified by QIAEXII (Qiagen), their ends blunted with T4 DNA polymerase (Promega) and ligated into pCR-Blunt II-Topo (Invitrogen) for sequence analysis.

Mouse stimulation and infection

Adult mice (6–12 week old) were administered MDP (300 μg/mouse) by i. p. injection and serum IL-6 levels were determined 3hrs after injection. To induce endotoxin shock, mice were pre-stimulated with MDP (300 μg/mouse) i. p. and challenged with ultrapure LPS (250 μg/mouse) from E. coli O55:B5 (Sigma)i. p. 24 hours later. For infection, mice were given E. faecalis (1 × 10⁸ CFU/animal) i. p. and bacterial loads in liver and spleen were determined by plating. TNF-α blocking IgG was a gift of T. Moore, the University of Michigan.

Statistical analysis

Statistically significant differences between two groups were determined by the two-tailed t-test with unequal variance (Aspin-Welch’s t-test). Bacterial counts of infected mice were analyzed by Man-Whitney U test. The survival rate of infected mice was analyzed using the log rank test. Differences were considered significant when p values were <0.05.

Nod2 contributes to the recognition of E. faecalis

The innate immune sensors that are involved in the recognition of E. faecalis, a common cause of infection and lethality in humans, are unknown. To assess a role for Nod2 in the recognition of E. faecalis, we first determine if products from the bacterium can induce the activation of Nod2 using an NF-κB reporter assay. The culture supernatant from E. faecalis induced robust Nod2-dependent NF-κB activation whereas extracts from the bacterial cell pellet induced little or no stimulation (Supplemental Fig. 1A). These results suggest that the bulk of the Nod2-stimulatory activity is released by the bacterium during growth. Consistent with the lack of the critical iE-DAP dipeptide motif in the PGN of E. faecalis, neither the bacterial pellet nor the culture supernatant induced Nod1-dependent NF-κB activation (Supplemental Fig. 1A). To determine whether Nod2 plays a role in the immune response to live E. faecalis, macrophages were infected with the bacterium at different bacterial/macrophage ratio and cytokine responses were measured. Infection of wild-type macrophages with E. faecalis induced the production of TNF-α and IL-6 and this response was reduced in macrophages lacking Nod2 (Fig. 1A, supplemental Fig. 1B). Consistently, phosphorylation of JNK and Iκ-Bα induced by E. faecalis infection was delayed and/or reduced in Nod2^−/− macrophages, while little or no difference was detected in p38 and ERK phosphorylation (Fig. 1B, supplemental Fig. 1C). These results indicate that Nod2 contributes to the cytokine response triggered by E. faecalis in macrophages.

Nod2 deficiency protects mice from systemic infection with E. faecalis

To assess whether Nod2 regulates the susceptibility to systemic infection, wild-type and Nod2^−/− mice were injected i. p. and survival was monitored over time. Notably, ~ 80 % of wild-type mice succumbed to infection as compared to only ~20% of the Nod2^−/− mice (Fig. 2A). The increased survival of Nod2^−/− mice was associated with reduced levels of IL-6 and TNF-α in the blood when assessed 3 hrs after infection (Fig. 2B). The reduced cytokine production was not explained by differential bacterial clearance because we found similar bacterial burden in the spleen and liver of wild-type and Nod2^−/− mice (Fig. 2C, supplemental Fig. 2A). These results indicate that Nod2 regulates susceptibility to systemic infection with E. faecalis and this is associated with reduced production of TNF-α and IL-6 without affecting bacterial clearance.

TNF-α is critical for induction of lethality in mice infected with E. faecalis

Given that increased survival of Nod2^−/− mice after E. faecalis infection was associated with reduced amounts of TNF-α, we asked whether inhibition of TNF-α protects mice from infection induced lethality. Infection of mice i. p. induced 100% mortality in mice treated with control IgG whereas only 20% of the mice injected with anti-TNF-α blocking antibody succumbed to infection (Fig. 2A). Treatment with anti-TNF-α antibody did not inhibit the production of TNF-α or IL-6 induced by E. faecalis infection (supplemental Fig. 2B). In contrast, administration of anti-IL-6 blocking antibody did not affect survival of mice infected with E. faecalis (supplemental Fig. 2C, 2D). The results indicate that TNF-α but not IL-6, is important for lethality associated with E. faecalis infection in our mouse model.

Mice homozygous for Nod2^2939iCstop mutation exhibit impaired recognition of MDP

Monocytes from individuals homozygous for the commonCD-associatedL1007fsinsC Nod2 mutation exhibit impaired cytokine response after stimulation with MDP (14). However, mouse macrophages homozygous for the equivalent L1007fsinsC Nod2 mutation displayed increased NF-κB activation in response to MDP which suggested that this genetic variant acts as a gain-of-function mutation in the mouse (15). To clarify these puzzling observations, we used a new strain of mice in which a Nod2 mutation homologous to the human L1007fsinsC was introduced into the Nod2 locus by homologous recombination (11). Sequencing of cDNA prepared from macrophages of homozygous Nod2^2939iCstop mice revealed the expected cytosine insertion followed by the TAG translation termination codon resulting in a truncated Nod2 protein lacking the last 33 amino acid residues (supplemental Fig. 3A, B). Immunoblotting analysis of Nod2 immunoprecipitates showed comparable levels of endogenous Nod2 in the intestinal tissue of wild-type and homozygous Nod2^m/m mice (supplemental Fig. 3C). To assess the function of the Nod2^2939iCstop mutation, we stimulated macrophages from wild-type, Nod2^−/−, and Nod2^m/m mice with MDP and monitored MAPK and NF-κB activation. Stimulation of wild-type macrophages with MDP induced phosphorylation of MAPKs and IκBα which was greatly reduced or abrogated in Nod2-deficient and homozygous Nod2^2939iCstop macrophages (Fig. 3A). Consistently, co-stimulation of macrophages from wild-type mice with MDP and lipoteichoic acid (LTA) increased the production of TNFα and IL-6 when compared to the response observed with LTA alone, which was impaired in Nod2^−/− and Nod2^m/m macrophages (Fig. 3B, supplemental Fig. 3D). Furthermore, i.p. administration of MDP induced the secretion of IL-6 in the serum of wild-type mice, but not in Nod2^m/m mice (Fig. 3C). To further assess the function of the Nod2^2939iCstop mutation in vivo, wild-type and Nod2^m/m mice were injected i.p. with 300 μg of MDP and 24 hrs later with 250 μg of LPS, a protocol that promotes lethality in mice (3). Nod2^m/m mice were protected from lethality induced by administration of LPS and MDP when compared to wild-type mice (Fig. 3D). These results indicate that the mouse Nod2^2939iCstop mutation is insensitive to MDP stimulation in vitro and in vivo.

Impaired cytokine responses induced by E. faecalis in macrophages homozygous for Nod2^2939iCstop mutation

We next examined the role of the Nod2^2939iCstop mutation in the regulation of pro-inflammatory cytokine responses after infection with E. faecalis. Infection of wild-type macrophages with E. faecalis induced secretion of IL-6 and TNF-α and these responses were significantly impaired in macrophages homozygous for the Nod2^2939iCstop mutation (Fig. 4A). As a comparison, Nod2^−/− and homozygous Nod2^2939iCstop macrophages produced comparable amounts of IL-6 and TNF-α in response to bacterial infection which was lower than in wild-type macrophages (Fig. 4A, supplemental Fig. 4). These results indicate that the Nod2^2939iCstop mutation is associated with defective recognition of E. faecalis in macrophages.

Reduced susceptibility to systemic infection with E. faecalis in mice homozygous for Nod2^2939iCstop mutation

We next examined the susceptibility of wild-type and Nod2^m/mmice to i. p. administration of E. faecalis. In these experiments, we crossed heterozygous Nod2^+/m mice with homozygous Nod2^m/m mice to generate littermate mice heterozygous and homozygous for the Nod2^2939iCstop mutation. We then challenged wild-type as well as heterozygous Nod2^+/m and homozygous Nod2^m/m littermatesi. p. with E. faecalis and assessed cytokine production and mouse survival overtime. Nod2^m/m mice exhibited increased survival compared to wild-type mice (67% vs 25%, p= 0.05) after i. p. challenge with E. faecalis (Fig. 4B). In contrast, heterozygous Nod2^+/m and wild-type mice exhibited comparable survival after bacterial challenge (Fig. 4B). The increased survival of Nod2^m/m mice was associated with reduced serum levels of IL-6 and TNF-α (Fig. 4C). These results indicate that homozygocity for the Nod2^2939iCstop mutation promotes survival after systemic infection with E. faecalis.

Using a newly developed model of the L1007fsinsC Nod2 mutation, we show that the resulting Nod2 truncated protein is impaired in MDP recognition and thus behaving as a loss-of-function mutation similar to that found in human cells (2, 14). There is no a clear explanation to account for the differences in results between our model and the model published by Maeda et al. (15). In contrast to our animal model, a TAG termination codon was not introduced after the cytosine insertion at position 2939 in the model reported by Maeda et al. which is predicted to result in a frameshift mutation leading to the addition of 42 amino acids not present in the CD-associated or normal Nod2 protein. Thus, it is possible that differences in the resulting Nod2 mutant protein between the two models could explain, at least in part, the discrepancy in results. We show here that mice homozygous for the CD-associated Nod2^2939iCstop mutation displayed impaired production of pro-inflammatory cytokines and improved survival in response to systemic infection with E. faecalis. These results suggest that the CD-associated Nod2^2939iCstop mutation exhibits a dual function. Namely, it promotes the susceptibility to CD, but also protects the host by limiting the production of harmful cytokines induced by systemic infection with E. faecalis. Because MDP synergizes with TLR ligands in the production of pro-inflammatory cytokines, it is likely that the role for Nod2^2939iCstop mutation in limiting the production of harmful cytokines and lethality in response to bacterial infection is not limited to E. faecalis. However, most studies to date have shown increased susceptibility of Nod2^−/− mice to infections with microbial pathogens (16). Thus, the contribution of Nod2 mutations in evolutionarily selecting for individuals who are L1007fsinsC remains unclear.