Different Roles of G Protein Subunits β₁ and β₂ in Neutrophil Function Revealed by Gene Expression Silencing in Primary Mouse Neutrophils^*

Introduction

Neutrophils are the most abundant leukocytes in the blood and play an essential role in the early stages of the innate immune responses by ingesting and killing invading pathogens. In response to inflammatory stimuli, neutrophils first adhere to and extravasate through blood vessels and then migrate through the interstitial tissue toward the site of inflammation. Although neutrophils play an important role in the host defense, uncontrolled inflammatory reactions are associated with a variety of pathological conditions, including ischemia-reperfusion injury during heart attack and strokes, arteriosclerosis, rheumatoid arthritis, and allergic reactions (1–3). Therefore, understanding how neutrophil recruitment and function is regulated is critical for developing potential treatments for a number of disorders.

Neutrophils are also a fine model system to study directional cell migration and chemotaxis because of their ability to migrate rapidly and directionally under a shallow gradient of chemoattractants. Chemotaxis is a fundamental biological process used by a variety of cell types and underlies a wide range of developmental, physiological, and pathophysiological events. It consists of two basic components, directionality and motility (4–8). Most of the neutrophil chemoattractants, including formyl-Met-Leu-Phe (fMLP),² bind to their specific cell surface receptors that are coupled to heterotrimeric G proteins, which upon activation regulate numerous downstream effectors. Studies in Dictyostelium cells demonstrated that the Gβ subunit plays a critical role in signal transduction to chemotaxis regulation (9, 10). However, the importance of Gβ subunits in neutrophil chemotaxis has yet been investigated.

Despite basic scientific and clinical importance of neutrophil research, it has been hindered by the fact that these cells are terminally differentiated, short lived, and thus not amenable to in vitro manipulations, including transfection. Targeted gene inactivation in mice has been the only approach to provide primary neutrophils for loss of function studies. Although these studies have provided novel insights into neutrophil biology, the approach is costly and time-consuming. Therefore, it is imperative to develop a more efficient approach to study neutrophils.

RNA interference has been shown to be a rapid and powerful tool for knocking down gene expression in a sequence-specific fashion. Compared with chemically synthesized small interfering RNA, short hairpin RNAs (shRNAs) can be stably expressed in hard-to-transfect primary cells and in whole organisms (11). Recently, the miR30-shRNA cassette has been reported to yield a higher level of shRNA and more efficient knockdown than a simple shRNA design (12). Using the same miR30-shRNA cassette, Zhu et al. (13) have silenced multiple target genes simultaneously to overcome isoform redundancy issues (14), demonstrating the powerful capabilities of this microRNA-based shRNA design. Although shRNA-mediated gene silencing was successful in neutrophil-like cell lines, such as differentiated HL-60, these cells may not faithfully recapitulate the biology of primary neutrophils. In addition, these cell lines cannot be used for in vivo studies. By taking advantage of pluripotent differentiation potentials of hematopoietic stem cells, we describe the development of a novel method to silence gene expression in primary neutrophils in mice using a retrovirus expressing shRNAs. Using this new method, we demonstrated that Gβ₂ is primarily involved in regulating directionality rather than motility of neutrophil chemotaxis, and Gβ₁ is involved in bacterial killing by neutrophils.

MATERIALS AND METHODS

Plasmids

The initial retroviral vector MIGR1 (mouse stem cell virus-internal ribosome entry site-green fluorescent protein-retrovirus-1) and the packaging vector pCL-ECO were generous gifts from Dr. Diane Krause (Yale University). For the LTR-YFP-shGβ₂ vector, we replaced GFP in MIGR1 with YFP-miR-shGβ₂, which was amplified by PCR from pSLIK-miR-shGβ₂ and carries a targeting sequence of TGCTCATGTATTCCCACGACAA (14, 15). For the CMV-YFP-shRNA vectors, the CMV promoter was amplified from the pAAV-MCS vector (Stratagene (Cedar Creek, TX)) by PCR and inserted between the LTR and YFP-miR-shRNA. miR-shRNA sequences for Gβ₁ knockdown were designed by using the RNA interference Codex algorithm (available on the World Wide Web). Four targeting sequences were tested (A, GCGACTCTTTCTCAGATCACAA; B, ATCTGGGACAGTTATACCACAA; C, AACATTATCTGTGGTATCACAT; D, GGCCGAGCAACTGAAGAACCAA). The D sequence was used for the knockdown studies in neutrophils. To generate plasmid containing tandem shRNAs, miR30-shGβ₂ was amplified by PCR and inserted downstream of miR-Gβ₁.

Td-Tomato was amplified and inserted into pGEX-3X (GE Healthcare) for the bacterial killing assay. All constructs were verified by sequencing.

Cell Culture

We used PHE (Phoenix Ecotropic) cells, which are capable of producing viral gag-pol and envelope proteins, as the packaging cell line (16). PHE and NIH 3T3 cells were maintained in 90% Dulbecco's modified Eagle's medium, 10% fetal bovine serum, 100 units/ml penicillin, and 0.1 mg/ml streptomycin at 37 °C under 5% CO₂ in humidified air.

Retrovirus Production and Infection

One day prior to transfection, PHE cells were seeded at a density of 3 × 10⁶ cells/T 75 flask. Retroviral vector and pCL-ECO were co-transfected into cells using Lipofectamine Plus (Invitrogen) according to the manufacturer's instructions. Two days later, the medium containing viruses was concentrated using Amicon Ultra columns (Millipore, Billerica, MA). For viral titer determination, serial dilutions of virus supernatants were added to NIH 3T3 cells in a 24-well plate, followed by centrifugation at room temperature to enhance the transduction efficiency. Twenty-four hours later, cells were analyzed by a flow cytometer.

Flow Cytometry Analysis

Allophycocyanin (APC)-CD11b, PerCP-B220, and APC-CD3ϵ antibodies were purchased from eBioscience (San Diego, CA). APC-Gr1 and Percp-Ly-6G antibodies were from BD (San Jose, CA). The single color flow analysis was done in the Guava EasyCyte Mini Base System (Millipore), and the multiple color flow analysis was performed in an LSR II fluorescence-activated cell sorting (FACS) analyzer (BD Biosciences). Cell sorting was performed by a FACS Aria sorter (BD Biosciences). Results were analyzed by FlowJo software (Treestar, Ashland, OR).

Western Blotting

Western blotting was performed with the following antibodies: anti-Ser(P)-473-Akt antibody (Cell Signaling Technology, Beverly, MA), anti-Gβ₂ and anti-GFP (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-β-actin (Sigma), and anti-β-tubulin antibody (collected from the supernatant of a hybridoma cell line). The proteins were detected by using the SuperSignal West Pico chemiluminescence substrate (Thermo Fisher Scientific, Rockford, IL).

Generation of Neutrophils from Virus-infected Bone Marrow Cells

C57BL/6 mice, aged 8–12 weeks, were obtained from Taconic (Germantown, NY). The donor mice were treated with 5-fluorouracil (Sigma) at 150 mg/kg to enrich hematopoietic stem cells in the bone marrow. Three days later, bone marrow cells were harvested from femurs and tibias and cultured in Iscove's modified Dulbecco's medium containing 20% endotoxin-free fetal bovine serum (Invitrogen), 50 ng/ml recombinant murine stem cell factor, 10 ng/ml recombinant murine interleukin-3, and 10 ng/ml recombinant human interleukin-6 (PeproTech, Rocky Hill, NJ) for 2 days. Cells were then infected twice with viruses in the presence of 4 μg/ml Polybrene (Millipore). The transduced bone marrow cells were transplanted back into lethally irradiated recipient mice (9.5 grays; γ-rays) by retro-orbital injection. Eight weeks later, the transplanted mice were euthanized for the further analysis. The use and care of animals were approved by the Institutional Animal Care and Use Committee at Yale University.

Neutrophil Preparation and Dunn Chamber Chemotaxis Assay

Neutrophils were isolated from bone marrows by using discontinuous Percoll gradient as described previously (17). The purity of the preparation was verified by Ly6G staining, which is above 95% pure for neutrophils. fMLP was purchased from Sigma. The chemotaxis assay using a Dunn chamber was carried out as described previously (18) with some modifications. To minimize inconsistency between assays, we monitored chemoattractant gradients using free fluorescein isothiocyanate dye. Only cells under certain gradient characteristics were analyzed and included in our statistical analysis (supplemental Fig. S1A). Time lapse image series acquired in the aforementioned chemotaxis experiments were analyzed using the MetaMorph image analysis software. The software calculates the x,y coordinate of the centroid of a cell that is designated for tracking in each of the images. Several parameters that reflect the chemotactic behaviors of a cell are obtained from these timed coordinate series. Because the cells in general do not move with a constant velocity, they often move a distance that is less than the noise level of the cell tracking algorithm in the short time interval between two consecutive frames. To exclude those meaningless tracking results from the data analysis, we set a cut-off of 7.5 μm, which represents one-half of an average body length of a polarized neutrophil, as the minimal distance that a cell has to travel in order for the coordinate to be included in the following analyses.

We computed the following parameters to quantify the chemotactic behaviors of a cell (supplemental Fig. S1B). Assuming that a cell migration trace consists of n points (p₁, p₂, … p_n) in that order so that they have coordinates (x_i,y_i)_{i = 1,2… . n}, respectively, let Δx_i = x_{i + 1} − x_i,Δy_i = y_{i + 1} − y_i. Then the distances between consecutive points are as follows.

The directionality error angle (α_i) was calculated as follows, α_i = (180/π)arccos(Δx_i/D_i), where i = 1, 2, … n. This measures the angle between the cell migration direction and the gradient direction. We take the average directionality angle for all p_i values. A smaller value indicates that the cell is more closely following the gradient. Motility is calculated as follows, motility = |p_n − p₀|/elapsed time. This measures the overall cell migration speed.

Air Pouch Model of Carrageenan-induced Synovitis

λ-Carrageenan was purchased from Sigma. Air pouches were generated by subcutaneously injecting 3 ml of sterile-filtered air on day 0 and day 3. At day 6, carrageenan suspension (5 mg in 0.5 ml of sterile, pyrogen-free saline) was injected into the air pouch. 4 h later, pouch exudates were recovered with 1 ml of cold phosphate-buffered saline containing 3 mm EDTA (19). The total cell count was measured using the Guava EasyCyte Mini Base System (Millipore). Cells were then stained with APC-CD11b and Percp-Ly-6G and subjected for flow cytometric analysis using an LSR II FACS analyzer. Neutrophils were defined as Ly-6G⁺CD11b⁺ cells.

Phagocytosis and Bacterial Killing Assay

Escherichia coli (DH10B) transformed with pGEX-Td-Tomato plasmid was induced by isopropyl 1-thio-β-d-galactopyranoside to express Td-Tomato, the red fluorescence protein. Bone marrow was isolated from mouse tibia and femur of hind legs and then incubated at 37 °C in the presence of bacteria expressing red fluorescence at a ratio of 1:10 for 15 min. Non-internalized bacteria were then removed by washing three times by centrifugation at 100 × g for 5 min in Hanks' buffer with 1% bovine serum albumin, and fluorescence intensity at this time point was used as a measurement of phagocytosis. Following this initial bacterial loading, cells were incubated at 37 °C for the time periods indicated prior to fixation with 2% paraformaldehyde. Bone marrow cells were then labeled with APC-conjugated anti-mouse Gr1 in order to identify the neutrophil population, and fluorescence was then assessed by flow cytometry using a BD LSRII FACS analyzer.

RESULTS

To develop an efficient method for loss-of-function study of mouse primary neutrophils, we tested whether the lentiviral miR30-embedded shRNA production system developed by Simon and colleagues (15, 20) would be able to silence gene expression in neutrophils in a scheme outlined in supplemental Fig. S2. Briefly, lentiviruses expressing GFP were used to infect mouse bone marrow cells, which were subsequently used to generate neutrophils after transplantation into lethally irradiated recipient mice. We found that this lentivirus-based system did not infect mouse bone marrow cells at a high efficiency (data not shown). We decided to switch to a mouse stem cell virus-based system because mouse stem cell virus infects hematopoietic stem/progenitor cells at high efficiencies (21). The insert encoding Venus fluorescence protein (a variant of YFP) and an shRNA targeting the β₂ subunit of G protein embedded within the miR30 sequence was subcloned from the lentiviral system into MIGR1, a mouse stem cell virus-based retroviral vector (Fig. 1A). We refer to this vector as LTR-YFP-shGβ₂. The reasons for choosing the Gβ₂ shRNA in this study were as follows: 1) the shRNA was shown to be effective and specific (15); 2) Gβ₂ is one of the two Gβs abundantly expressed in mouse neutrophils based on our expression microarray analysis (Fig. 1B); and 3) the role of Gβ in neutrophil chemotaxis has not been investigated.

We infected bone marrow cells isolated from C57BL/6 mice with LTR-YFP-shGβ₂ virus and transplanted them into lethally irradiated C57BL/6 recipients. After 8 weeks of recovery and repopulation, neutrophils were isolated from the transplanted mice and analyzed for YFP expression. As shown in Fig. 1C, 44.92% of isolated neutrophils were YFP-positive, suggesting that this retroviral vector provides reasonable infection efficiency. We subsequently sorted the YFP-positive neutrophils (Fig. 1D) and analyzed them for shRNA-mediated knockdown efficiency. Because YFP and the shRNA were expressed from the same transcript, we expected the YFP-positive cells to express the shRNA. We observed about a 50% reduction in Gβ₂ expression in neutrophils expressing YFP (Fig. 1E). However, little effect on chemoattractant (fMLP)-induced phosphorylation of Akt at Ser-473 was observed. This phosphorylation event is known to depend on Gβγ (14, 22). Therefore, we hypothesized that the LTR promoter-based vector may not produce sufficient shRNA to allow effective knockdown of Gβ₂ and result in the expected functional defects.

To improve the shRNA production, we decided to add a strong transcriptional promoter/enhancer by inserting a cytomegalovirus (CMV) promoter with a β-globin intron between the 5′-LTR and the YFP-miR30-shRNA expression cassette (Fig. 2A). The β-globin intron enhances transcriptional activities as an enhancer-like element (23). A second construct with the luciferase shRNA embedded in the miR30 backbone in place of the Gβ₂ shRNA was made as a control for our studies described below. These two new constructs are referred to as CMV-YFP-shGβ₂ and CMV-YFP-shLuc. We first tested these new constructs by infecting NIH 3T3 cells and found that cells infected with viruses generated from the new constructs (CMV-YFP-shLuc or -Gβ₂) expressed higher levels of YFP than those generated from LTR-YFP-shGβ₂ at the same multiplicity of infection (Fig. 2, B and C). Importantly, despite the same Gβ₂ shRNA sequence in both LTR- and CMV-driven vectors, CMV-YFP-shGβ₂ yielded much more efficient knockdown of Gβ₂ expression than LTR-YFP-shGβ₂ (Fig. 2D). These results suggest that the CMV promoter coupled with the β-globin intron sequence leads to higher expression levels than the viral LTR and that higher shRNA expression translates into more effective gene expression knockdown.

Next, we tested whether the modified vector would be more efficient in silencing gene expression in mouse neutrophils. The CMV-YFP-shLuc and CMV-YFP-shGβ₂ viruses were used to infect mouse bone marrow cells, which were subsequently transplanted into lethally irradiated recipient mice. Fig. 3A shows a representative set of flow cytometric analyses of neutrophils isolated from these transplanted mice. In this experiment, 30% of CMV-YFP-shGβ₂ neutrophils were YFP-positive, whereas close to 60% of CMV-YFP-shLuc neutrophils were YFP-positive. The YFP-positive neutrophils were isolated by FACS, and their purity is shown in Fig. 3B. The sorted YFP-positive neutrophils were then subjected to Western analysis. As shown in Fig. 3C, the level of Gβ₂ was markedly reduced in sorted YFP-positive neutrophils expressing shGβ₂ compared with neutrophils from non-transplanted mice or neutrophils expressing shLuc. In all of the experiments performed, there was 70–85% reduction in Gβ₂ expression levels in cells expressing shGβ₂ compared with the controls. Importantly, there was a clear reduction in fMLP-induced Akt phosphorylation in cells expressing YFP-shGβ₂ compared with the controls (Fig. 3C). Of note, silencing Gβ₂ expression in neutrophil did not affect the expression of Gβ₁ or Gα_i2 (Fig. 3C).

Because Gβ₁ is also highly expressed in murine neutrophils (Fig. 1B) and it may have a redundancy function as Gβ₂, we also tried to silence Gβ₁ expression using our new vector. Four different shRNAs targeting Gβ₁ were designed, and the most potent shRNA (shGβ₁-D) was identified by significantly suppressing endogenous Gβ₁ expression in NIH 3T3 cells (supplemental Fig. S3). This shRNA was used in the following study. After bone marrow transplantation, we sorted out the YFP-positive neutrophils transduced with Gβ₁ shRNA or control luciferase shRNA (Fig. 4A) and performed Western analysis. As shown in Fig. 4B, the level of Gβ₁ was significantly reduced in sorted YFP-positive neutrophils expressing shGβ₁ compared with control neutrophils from non-transplanted mice or neutrophils expressing shLuc.

One of the main powers of the miR30-shRNA system is to simultaneously knock down multiple different gene targets (13). To exploit this possibility in our system, we tried a double knockdown of Gβ₁ and Gβ₂ in neutrophils. The second miR-shRNA was inserted downstream of the first miR-shRNA, and both shRNAs were driven by the enhanced CMV promoter (Fig. 4C). Similarly, we sorted out the YFP-positive neutrophils transduced with Gβ₁ shRNA and Gβ₂ shRNA (double knockdown) or control luciferase shRNA (Fig. 4D), and we observed the efficient suppression of Gβ₁ and Gβ₂ expression in neutrophils (Fig. 4E), suggesting the successful knockdown of multiple gene targets in vivo.

Next, we performed three functional assays for transduced neutrophils. First, we tested the effect of Gβ knockdown on in vitro neutrophil chemotaxis using a Dunn chamber, in which a shallow fMLP gradient was established and cell migration was tracked using time lapse videomicroscopy. Two key parameters were obtained from analysis of the time lapse image series: directionality error (reflecting how well a cell follows the chemoattractant gradient) and motility (see “Materials and Methods” for details). Significant portions of the neutrophils isolated from transplanted mice were YFP-negative. Supplemental Fig. S4A shows bright field and fluorescence images of neutrophils in Dunn chambers, in which YFP-positive and -negative neutrophils can be readily recognized and tracked. These YFP-negative cells have little or no shGβ₂ expression and therefore normal levels of Gβ₂ protein (supplemental Fig. S4, B and C). Thus, these YFP-negative cells served as excellent internal controls for the Dunn chamber chemotaxis assay, which are known to be variable. In addition, paired statistical analyses were used to identify small differences in chemotaxis parameters caused by gene silencing. Analysis of chemotactic parameters of YFP-positive cells and negative cells revealed that YFP-positive neutrophils isolated from CMV-YFP-shGβ₂ virus-infected mice showed impaired directionality compared with YFP-negative cells (Fig. 5A). Interestingly, no significant directionality defect was detected in Gβ₁-silenced neutrophils compared with control cells (Fig. 5A), and no further directionality defect was observed in Gβ₁ and Gβ₂ double knockdown neutrophils as compared with Gβ₂-silenced cells (Fig. 5A), suggesting that Gβ₂ is the major isoform responsible for neutrophil directionality. The effect of Gβ₁ knockdown or Gβ₂ knockdown on motility appeared to be insignificant (Fig. 5B). Neutrophils suppressing both Gβ₁ and Gβ₂ expression (Fig. 5B) showed a modest but significant reduction in motility. In addition, ∼30% of Gβ₁/Gβ₂ double knockdown neutrophils failed to respond to fMLP and were immobile, whereas knockdown of either Gβ subunit had no significant effects on the number of responding cells (Fig. 5C). As important controls, there were no differences between YFP-positive and -negative neutrophils isolated from mice transplanted with CMV-YFP-shLuc virus-infected bone marrow cells (Fig. 5, A and B). Therefore, these results together indicate that Gβ₂, but not Gβ₁, has an important role in neutrophil directionality regulation, whereas both Gβ subunits are involved in motility regulation.

To examine neutrophil recruitment in vivo, we used the air pouch model (24). In this model, subcutaneous injection of air into dorsal surface of mice results in the formation of an air pouch, which has a lining morphologically similar to the synovium. Carrageenan, polysaccharide extracted from red seaweeds, was injected into the pouch to induce robust inflammation, as indicated by an increase in total neutrophil number and higher neutrophil percentage in the pouch exudates compared with those in mice injected with saline (data not shown). Among these neutrophils recruited into the pouch, two or three populations (YFP-low, YFP-medium, and YFP-high) were observed based on their YFP expression (Fig. 6A). In our analysis, we refer to YFP-high cells as YFP-positive cells and YFP-low cells as YFP-negative cells. As indicated in supplemental Fig. S4, YFP-negative cells also served as internal controls for YFP-positive cells in this assay. For each animal, the ratio between YFP-positive neutrophils and YFP-negative neutrophils in the pouch exudates (Fig. 6A, bottom), which reflects the migration ability of transduced neutrophils, was normalized based on the same ratio in the blood (Fig. 6A, top). As expected, neutrophils expressing luciferase shRNA (shLuc) migrate normally in vivo (the ratio of YFP⁺/YFP⁻ is 0.97 ± 0.05; Fig. 6B). However, the infiltration of Gβ₂-silenced neutrophils was markedly inhibited (the ratio of YFP⁺/YFP⁻ is 0.47 ± 0.12). Although we observed the inhibited migration in Gβ₁-silenced neutrophils (the ratio of YFP⁺/YFP⁻ is 0.72 ± 0.22; Fig. 6B), the difference is not statistically significant compared with that in shLuc group. Importantly, the more severe migration defect was detected in Gβ₁ and Gβ₂ double knockdown neutrophils (the ratio of YFP⁺/YFP⁻ is 0.29 ± 0.11; Fig. 6B). These data suggest that both Gβ subunits play important roles in neutrophil recruitment in vivo, whereas Gβ₂ appears to be a more dominant isoform than Gβ₁ in regulating neutrophil migration in vivo.

Finally, we performed phagocytosis and bacterial killing assays using neutrophils isolated from transplanted mouse bone marrow. We developed a flow cytometry-based assay to assess these two processes. We incubated neutrophils with E. coli expressing Td-Tomato, a red fluorescence protein (25), at 37 °C for 15 min to allow phagocytosis to occur. After differential centrifugation to remove the free bacteria, the levels of Td-Tomato were determined by flow cytometry at varying time points. The initial level of red fluorescence reflects phagocytosis, whereas the reduction of red fluorescence reflects bacterial killing. To validate this assay, we compared this new method with the one that counts actual bacterial numbers, and we observed the similar results between this flow-based method and the conventional colony-forming unit method (supplemental Fig. S5B). In the presence of diphenyliodonium, an inhibitor of NADPH oxidase complex, no decrease in red fluorescence was observed over the 30-min experimental time course, whereas we did detect a significant reduction of red fluorescence in the absence of diphenyliodonium inhibitor (supplemental Fig. S5C). Moreover, we did not observe the decrease of red fluorescence when fluorescence-labeled bacteria were incubated with neutrophils in ice for 30 min (supplemental Fig. S5A). These data further demonstrate that the reduction of red fluorescence measured by flow cytometry is due to neutrophil-mediated bacterial killing.

Knockdown of Gβ₁ did not alter the ability of cells to phagocytose bacteria when the fluorescence intensity of YFP⁻ and YFP⁺ cells was compared after the 15-min ingestion period (Fig. 7, A and C). Knockdown of Gβ₂ caused a slight but statistically insignificant decrease (Fig. 7E). However, knockdown of both Gβ subunits led to a significant reduction (Fig. 7G), suggesting that both subunits are involved in the regulation of phagocytosis. With regard to bacterial killing, only knockdown of Gβ₁ demonstrated a moderate, but significant, inhibition over the time course indicated (Fig. 7D). In contrast, Gβ₂-silenced neutrophils and neutrophils expressing shLuc control showed no significant changes in bacterial killing (Fig. 7, B and F). These data suggest that signaling events downstream of Gβ₁ may facilitate the efficient destruction of phagocytosed bacteria in neutrophils. Although the mechanisms for this Gβ₁-mediated bactericidal effect are not known, Gβ₁ may regulate this effect via regulating superoxide production or degranulation. The lack of effect of Gβ₁/Gβ₂ double knockdown on the apparent killing (Fig. 7H) may be due to fewer bacteria that were phagocytosed by the double knockdown cells, obscuring the moderate inhibition that resulted from Gβ₁ knockdown. Nevertheless, these results are consistent with the conclusion that the lack of effect of Gβ₂ knockdown on bacterial killing may not be due to the compensation by Gβ₁.

DISCUSSION

In this study, we have developed a method by which gene expression can be effectively silenced in primary mouse neutrophils. This method uses a combination of bone marrow transfer and microRNA-embedded shRNA production to achieve highly efficient gene expression knockdown in primary neutrophils. Using this method, we successfully silenced Gβ₁, Gβ₂, or both Gβ₁ and Gβ₂ in neutrophils and uncovered unexpected roles of these G protein subunits in regulating neutrophil biology.

Retroviral transduction following transplantation of genetically manipulated hematopoietic stem cells is a powerful tool for studying hematopoietic cells in vivo. This method has been successfully used in not only myeloid cells, such as macrophage (26) and dendritic cells (27), but also lymphoid cells (28–30). However, most of studies applied gain-of-function strategy. Our new method has several distinct advantages. First, it allows loss-of-function studies of neutrophils and will provide an efficient alternative to the time-consuming gene targeting approach, which thus far had been the only way to study loss of function of neutrophils. Advancement in the field of neutrophil biology has been in part limited by the long time frame to generate genetically modified primary neutrophils. In contrast to more than 1 year needed for generation of a knock-out mouse line, our method only takes 3 months to produce the mice for the study. In addition, the method allows studying neutrophil functions in various in vivo models, as suggested in our air pouch model (Fig. 6), which is a clear advantage over knockdown studies in neutrophil-like cell lines.

The second advantage of this method is that cells unaffected by gene knockdown are generated simultaneously serving as excellent internal assay controls. This is particularly beneficial in experiments subjected to individual mouse and systematic variations, including the in vivo studies. In this study, we use YFP-negative neutrophils as internal controls for an in vitro chemotaxis assay (Fig. 5), in vitro bacterial killing assay (Fig. 7) and in vivo air pouch model (Fig. 6).

The third advantage is that this method may be adapted to express proteins in neutrophils. By generating MIGR-CMV vectors with different fluorescence proteins with differing emission spectra, the method expands possibilities for multiple labeling neutrophils for both loss-of-function and gain-of-function studies.

Because hematopoietic stem cells can differentiate into multiple-lineage hematopoietic cells, our approach will very likely be applicable to the other hematopoietic lineages as well. To address this question, we did FACS analysis in spleen cells of MIGR-CMV-miR-shLuc transplanted mice and wild type mice. Using B220 as a B cell marker and CD3ϵ as a T cell marker, we detected a B220⁺YFP⁺ double positive population and a CD3ϵ⁺YFP⁺ double positive population in spleen of MIGR-CMV-miR-shLuc transplanted mice but not in wild type mice (supplemental Fig. S6), suggesting that the method of retroviral transduction followed by bone marrow transplantation can transduce myeloid and lymphoid cells as well as other hematopoietic cells. Therefore, our new vectors will provide important tools to study gene functions in primary hematopoietic cells in vivo and in vitro.

This study demonstrates that G β₂ knockdown primarily affected directionality of neutrophil chemotaxis in a shallow fMLP gradient, whereas knockdown of Gβ₁ had little effect. On the other hand, both Gβ subunits are involved in motility regulation, because knockdown of either had insignificant effects, whereas knockdown of both resulted in a significant reduction in cell motility and the number of immotile cells. These conclusions were supported by observations in vivo using an air pouch model and therefore suggest that Gβ₁ and Gβ₂ may regulate differing aspects of some neutrophil biology. This conclusion is further supported by the observation that Gβ₁ knockdown suppressed neutrophil-mediated bacterial killing, whereas Gβ₂ knockdown was ineffective in this regard. Meanwhile, both Gβ subunits appear to be involved in bacterial phagocytosis regulation. Indeed, previous studies in a macrophage-like cell line have suggested that the roles of Gβ₁ and Gβ₂ in cell migration differ (14). This study therefore extends the idea that Gβ₁ and Gβ₂ are not entirely redundant in their functions.

Genetic studies in Dictyostelium suggest that Gβ is required for phagocytosis and chemotaxis (31). However, our knockdown of two major Gβ subunits in neutrophils led to partial effects on chemotactic responses and phagocytosis. The lack of robust effects in some of the assays may be due to incomplete inactivation of the target genes. Because the expression levels and phenotype outcomes are not linear, an apparent efficient knockdown of the expression of a gene may fail to lead to a robust phenotype. This is an obvious drawback of this type of method. In addition, other Gβ subunits may also be expressed in neutrophils although they were not detected at high levels by our microarray analyses, which may not be reliable for estimating protein levels. Nevertheless, the methods outlined in this paper allow quick determination of a given gene for its roles in regulating a wide array of neutrophil activities and lay the groundwork for more thorough future studies.

Supplementary Material