Downstream class switching leads to IgE antibody production by B lymphocytes lacking IgM switch regions

IgH CSR to IgE Occurs at Nearly Normal Levels in B Cells Lacking Sμ.

To further elucidate mechanisms that target AID during IgH CSR, we have studied mice generated previously by gene-targeted mutation that harbor an essentially complete deletion of the entire 4.6-kb Sμ region in their germline (13). Mice homozygous for this Sμ deletion mutation (Sμ^−/− mice) show a great reduction in IgH CSR to all tested antibody classes, including IgG3, IgG2b, IgG1, IgG2a, and IgA (13). However, CSR to IgE was not previously studied in these mice. To further characterize potential IgH CSR defects in Sμ^−/− mice, we purified splenic B cells from WT and Sμ^−/− spleens and stimulated them in vitro with anti-CD40 and IL-4 to stimulate CSR from IgM to IgG1 and IgE. We assayed for CSR to IgG1 by surface staining and flow cytometry at days 2, 3, and 4 of stimulation. Consistent with previous studies (13), we observed greatly decreased (between 5- and 10-fold) IgH class switching to IgG1 at all analyzed time points (Fig. 1 A and B). We confirmed this finding by hybridoma analyses that showed increased levels of IgM-expressing hybridomas and greatly decreased levels of IgG1-expressing hybridomas from Sμ^−/− versus WT B cells (Fig. 1C and Table S1).

IgE class switching cannot be readily analyzed by flow cytometry, because anti-CD40 treatment induces up-regulation of CD23 (FcεRII), the Fc receptor for IgE, on activated B cells (36), which leads to binding of soluble IgE antibodies to non–IgE-producing B cells and causes false-positive staining. Therefore, we analyzed IgE switching by assaying the frequency of IgE-producing hybridomas generated from day 4 anti-CD40 plus IL-4 stimulated B cells. Under our current stimulation conditions, activated WT B cells switch to IgE at quite substantial levels; indeed, ∼40% of the recovered hybridomas were IgE producers (Fig. 1C and Table S1) (27). In this regard, our stimulation conditions also seem to give very high levels of IgG1 class switching (Fig. 1C) (27, 37). Unexpectedly, Sμ^−/− B cells also displayed very high levels of IgE switching; we recovered IgE-expressing Sμ^−/− hybrdomas at nearly 70% the frequency of WT IgE-producing hybridomas. Indeed, the frequency of IgE-expressing Sμ^−/− B hybridomas was more than 3-fold greater than that of IgG1-expressing Sμ^−/− hybridomas (Fig. 1C and Table S1).

To further elucidate the nature of the apparently high level of IgE class switching in Sμ^−/− B cells and to determine if it truly represented CSR, we employed a PCR approach, using primers from Iμ and just downstream of Sε, to isolate potential CSR junctions from a series of WT and Sμ^−/− IgE-expressing hybridomas (Fig. S1 Upper). We were able to isolate junctions from ∼80% of assayed WT and Sμ^−/− B-cell hybridomas, confirming that IgE switching had occurred through a recombination/deletion event. The recovered WT junctions were similar to those previously reported (38). Thus, they frequently contained microhomology (MH) at the junctions and less frequently were direct with no overlapping nucleotides, or they contained insertions. These WT Sμ to Sε CSR junctions, similar to CSR junctions (31, 38), linked sequences in the more 5′ portion of Sμ with sequences in the more 3′ portion of Sε (Fig. S1), perhaps reflecting PCR biases of the assay, AID targeting hotspots, or continued AID activity and ISD within fused Sμ/Sε regions. CSR junctions from the Sμ^−/− B-cell hybridomas occurred in a similar region of Sε as those recovered from WT. As expected (13), the junctions mostly occurred in the region just upstream of Sμ, but one junction occurred in a plasmid sequence inserted through gene targeting and the other occurred in the 5′ portion of Cμ (Fig. S1). Based on these findings, we conclude that B cells lacking the donor Sμ region utilize sequences outside of Sμ to undergo substantial levels of class switching to IgE.

Frequent Rearrangement of Sγ1 in Normal and Sμ-Deleted B Cells in the Absence of CSR to Sμ.

To further analyze factors that may regulate AID targeting on downstream S regions, we assayed for ISD in Sγ1 of IgM-secreting hybridomas generated from day 4 anti-CD40 plus IL-4 stimulated WT and Sμ^−/− B cells. To assay for potential rearrangements of Sγ1 that did not involve bona fide CSR, we digested genomic hybridoma DNA with EcoRI and then used Southern blotting to assay for non-germline fragments that hybridized to an Iγ1 probe. The Iγ1 probe derives from sequences just upstream of the Sγ1 region and hybridizes to an ∼17-kb EcoR1 fragment that encompasses the Iγ1 exon and Sγ1 region; therefore, any rearrangement within this region (except for CSR, which deletes the Iγ1 exon) will alter the size of the EcoRI fragment that hybridizes to the Iγ1 probe (Fig. 2A Upper; Fig. S2). In marked contrast to other studies, we found, in three independent sets of IgM-secreting WT hybridomas, that nearly 20% of the IgH alleles had undergone non–CSR-associated Sγ1 rearrangements (Fig. 2 A and B; Table S2). Thus, our findings indicate that, under our anti-CD40 plus IL-4 activation conditions, AID targets the downstream Sγ1 region independently of Sμ to Sγ1 CSR on that IgH allele. Strikingly, we found that nearly 80% of IgM-producing hybridomas isolated from three sets of anti-CD40 plus IL-4–stimulated Sμ^−/− B cells contained Sγ1 rearrangements on alleles in which Sγ1 had not undergone bona fide CSR with Sμ (Fig. 2 A and B; Table S2). Thus, there is a substantial accumulation of apparent AID targeting events at Sγ1 in the absence of an upstream donor Sμ.

Frequent Mutation of the Iγ1/Sγ1 Region in the Absence of Rearrangement to Sμ.

To further test whether or not AID can target downstream S regions independently of initiating a bona fide CSR event, we assayed for SHM of sequences within the region covering the 3′ portion of Iγ1 through the 5′ portion of Sγ1 after anti-CD40 plus IL-4 stimulation of WT and Sμ^−/− B cells for 7 days. This ∼1.6-kb region, which contains about 500 bp from the 3′ end of the Iγ1 exon and then extends ∼1.1 kb into the 5′ portion of Sγ1, has been assayed similarly for AID-initiated hypermutations by other groups (29, 30). Analyses of mutations within the Iγ1/Sγ1 region from three sets of activated WT and control AID^−/− B cells revealed a significantly higher mutation level in the WT B cells (∼4 × 10⁻⁴/bp versus 3 × 10⁻⁵/bp) (Fig. 3A; Table S3). Moreover, activated Sμ^−/− B cells had an even higher level of mutations within the Iγ1/Sγ1 region (∼1.4 × 10⁻³/bp) (Fig. 3A). In addition, there was a higher level of mutations within this given sequence from the Sμ^−/− samples than in WT samples (Fig. 3B). Among the scored mutations, which include point mutations, insertions, and deletions, there seemed to be an increased frequency of deletions in the Iγ1/Sγ1 sequences from the Sμ^−/− samples (Table S3), potentially reflecting increased AID targeting. However, the overall spectrum of point mutations was similar between WT and Sμ^−/− sequences, consistent with the same intact mutation mechanism in both (Fig. S3). These results provide further evidence that AID targets downstream S regions independently of Sμ and moreover, that AID-initiated mutations are greatly increased in downstream S regions on IgH alleles that lack Sμ.

Frequent Recombination Events Between Sγ1 and Sε in the Absence of Recombination with Sμ.

To investigate AID targeting efficiency at downstream S regions, we assayed for Sε rearrangements in the same sets of IgM-producing hybridomas in which we assayed for Sγ1 rearrangements. We first employed Southern blotting to assay genomic DNA from these hybridomas for rearrangements within Sε. For this purpose, we assayed BamHI- or EcoRI-digested DNA for hybridization to an Iε probe and separately, for hybridization to a Cε probe to detect potential Sε ISD (Fig. 4A Upper; Fig. S4). We noted that most of these hybridomas clearly arose from activated B cells that had not undergone CSR to Sγ1 involving Sμ but that had undergone some type of Sγ1 rearrangement, because they contained two distinct, rearranged Iγ1-hybridizing alleles (Fig. 2A). Despite the apparently high level of IgE switching and particularly high frequency of Sγ1 rearrangements that did not involve CSR with Sμ in Sμ^−/− B cells, we detected only one potential Sε ISD with the Iε probe in 20 Sμ^−/− IgM-producing hybridoma clones (Fig. S4). However, when DNA from the same set of Sμ^−/− IgM-producing hybridomas was assayed by hybridization to a Cε probe, we observed a substantial number of rearrangements (Fig. 4B Upper). Because many of these Sμ^−/− IgM-producing hybridomas contained two rearranged Iγ1-hybridizing alleles (Fig. 2A), the rearrangements detected with the Cε probe cannot all be explained by the recombination events on the Sμ-deleted allele that lead to class switching (Fig. S1). Additionally, as outlined above, they are not Sε ISD. Therefore, we considered the possibility that they represent downstream CSR events between Sγ1 and Sε. In support of this notion, stripping and reprobing these blots with an Iγ1 probe revealed that a substantial proportion of the Sε rearrangements detected with the Cε probe are exactly the same size as the Iγ1-hybridizing rearrangements (Fig. 4 A and B; common bands are indicated with asterisks).

To directly test for downstream CSR between Sγ1 and Sε in activated Sμ^−/− cells, we assayed for Sγ1–Sε junctions in genomic DNA from a set of IgM-producing Sμ^−/−-activated B-cell hybridomas through PCR with a forward primer derived from the 3′Iγ1 region and reverse primer derived from the region immediately downstream of Sε (Fig. 4A Lower). In unrearranged genomic DNA, the two PCR primers are derived from regions more than 60 kb apart, and therefore, they would only be amplified if they underwent a rearrangement, such as an Sγ1 to Sε recombination, that placed them more proximal to each other. Although we did not amplify bands by this approach from the WT IgM-secreting B-cell hybridoma DNA, we amplified bands of distinct sizes from 15 of 42 Sμ^−/− IgM-secreting B-cell hybridomas (Fig. 4C). DNA of cloned Iγ1/downtream Sε PCR fragments from six Sμ^−/− IgM-producing hybridomas confirmed that each harbored a unique Sγ1 to Sε junction (Fig. S5). These findings show that Sγ1 and Sε can harbor AID-initiated breaks simultaneously and undergo a form of downstream CSR in the absence of bona fide CSR with Sμ.

Mice.

Sμ^−/− mice were generated previously (13) and were maintained with a homozygous 129/SvJ IgH locus background. The genotype of each experimental mouse was confirmed by Southern blotting analysis. Sμ^−/− mice were analyzed at 8–16 weeks of age with age-matched controls that included WT mice on 129/SvJ background and AID^−/− mice (provided by Dr. Tasuku Honjo). All experiments with mice followed the protocols approved by Boston Animal Care Facility of the Children’s Hospital, Boston, MA 02115.

CSR Assay and FACS Analysis.

B cells were harvested from spleens of age-matched mutant mice and controls and purified by selection of the CD43-negative population through a mouse B-cell enrichment kit (STEMCELL TECHNOLOGIES). Purified B cells were cultured in RPMI-based medium containing 50 μM β-ME and 15% FCS (as described in ref. 37) in the presence of anti-CD40 antibodies (eBioscience) and IL-4 (20 ng/mL; eBioscience) to stimulate CSR to IgG1 and IgE. Cells were kept under 0.5 million/mL and assayed by surface staining and flow cytometry on days 2, 3, and 4 with anti-IgG1-FITC and anti-B220-PE-Cy5 antibodies as previously described (38).

Hybridoma Analysis for CSR.

Five to ten million anti-CD40/IL-4–stimulated B cells from each mouse were fused with NS-1 fusion partner myeloma cells on day 4 and recovered after 7 days selection with 1× Hypoxanthine Aminopterin Thymidine (HAT) medium. Single clones from each well were picked and screened by ELISA on their supernatants with IgM, IgG1, and IgE capturing and revealing antibodies (Southern Biotech). Only clones that were single positive for one of the three antibody classes were counted. Clones that were negative for all IgH isotypes or positive for more than one IgH isotype were found at very low levels (below 5% of total clones) and not taken into the calculations.

Somatic Hypermutation Assay.

Five to 10 million anti-CD40/IL-4–stimulated B cells were harvested on day 7 for genomic DNA extraction with DNeasy Blood and Tissue Kit (QIAGEN). iProof High-Fidelity DNA polymerase (Bio-Rad Life Sciences) was used to amplify the Iγ1/Sγ1 region with forward primer Sg1.2F (TGTCAATCCTGTTCTTAGTCAATCA) and reverse primer Sg1.2R (CCATCAGCTCTAGCCATGTAGTATT). PCR products were purified and cloned into vectors as previously described (37). Plasmids with proper inserts were sequenced, and a 1,640-bp region from the 3′ end of Ig1 into 5′ Sg1 was analyzed.

Southern Blotting Analysis.

At least 5 μg genomic DNA isolated from each hybridoma clone was digested with EcoRI or BamHI overnight and run on a 0.7% agarose gel. DNA was transferred from the gels to membranes that were hybridized with corresponding probes (Figs. 2 and 4 and Figs. S2 and S4), washed, and put on XAR film (Kodak Biomax) for exposure.

Switch-Region Junction Cloning.

Sμ–Sε and Sγ1–Sε junctions were amplified by Advantage cDNA polymerase Mix and PCR Kits (Clontech) following their protocols. For Sm–Se junction cloning, we used forward primer ImF1 (ACTCAGTCAGTCAGTGGCGTGAAGGGCT) and reverse primer Sε-1.Rv (CATCAGGCTTTGCTCACTCA). For Sγ1–Sε junction cloning, we used forward primer Sg1.2F (TGTCAATCCTGTTCTTAGTCAATCA) and reverse primer Sε-1.Rv (CATCAGGCTTTGCTCACTCA).