Heparan Sulfate Is Required for Embryonic Stem Cells to Exit from Self-renewal^*

Isolation of ESC Lines

The generation of the conditional Ext1 allele (Ext1^flox) and Ext1^flox/flox mice was reported previously (26). Ext1^flox/flox ESCs were derived from Ext1^flox/flox blastocysts according to a standard protocol (27). To obtain Ext1 null (Ext1^−/−) daughter ESC lines, Ext1^flox/flox ESCs were transfected with pBS513 EF1 α Cre (Addgene) using Lipofectamine 2000, followed by single cell cloning. The alleles of Ext1^flox and Ext1⁻ were identified by PCR analysis using the following primers. The Ext1^floxed allele was amplified using the following primers: 5′-GGAGTGTGGATGAGTTGAAG-3′ (forward) and 5′-CAACACTTTCAGCTCCAGTC-3′ (reverse). The Ext1⁻ allele was amplified using the following primer pair: 5′-GGAGTGTGGATGAGTTGAAG-3 and 5′-GAGAACAGGTACCCATGTTC-3′. Cycling parameters for PCR were 95 °C for 15 min, 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min repeated for 40 cycles and then 72 °C for 10 min.

Culture and Differentiation

ESCs were maintained in medium consisting of Dulbecco's modified Eagle's medium (Hyclone) supplemented with 10% fetal bovine serum, 10% knockout serum replacement (Invitrogen), l-glutamine, 100 units/ml penicillin, 100 μg/ml streptomycin, 0.1 mm β-mercaptoethanol at 37 °C under 5% CO₂, supplemented with 1000 units/ml leukemia inhibitory factor (LIF) (ESGRO, Chemicon). For differentiation into embryoid bodies (EBs), ESCs were trypsinized and transferred into bacterial dishes at 5 × 10⁴ cells/ml in 15% fetal bovine serum without the addition of LIF, and medium was changed every second day. Differentiation in adherent serum-containing culture was achieved in 10% fetal bovine serum, 10% knockout serum replacement without LIF. Serum-free culture was performed in Dulbecco's modified Eagle's medium supplemented with 1× N2 (Gemini), 1× B27 (Gemini), 50 μg/ml bovine serum albumin (Sigma), and 10 ng/ml FGF-4.

Self-renewal Assay

ES cells were seeded at clonal density and cultured for 5 days in ES medium with LIF. Cells were washed, fixed, and tested for alkaline phosphatase (AP) activity using an AP kit (Millipore). One hundred colonies were scored, and the percentage of AP-positive colonies was calculated. Dome-shaped colonies with tightly packed AP-positive cells were considered undifferentiated. Colonies with a mixture of stained and unstained colonies and with flattened and non-uniform morphology were considered differentiated.

Flow Cytometry

For detection of cell surface HS, ESCs were incubated with an anti-HS antibody (H10E4, Seikagaku) at 1:500 and labeled with a secondary antibody (anti-mouse IgM-fluorescein isothiocyanate) before fluorescence-activated cell sorting analysis. FGF cell surface binding was performed as described previously (28). Briefly, ESCs were detached with 2 mm EDTA in PBS for 10 min at room temperature. Cells were incubated with 0.6 μg/ml biotinylated FGF-2 in buffer (0.5% bovine serum albumin, 2 mm EDTA in PBS) for 1 h on ice. Bound FGF-2 was detected by flow cytometry with avidin-fluorescein isothiocyanate (1:1000; R&D Systems).

Immunofluorescence

Cells were fixed in 4% paraformaldehyde for 10 min at room temperature, washed three times with PBS, and then incubated for 1 h in blocking buffer (2% goat serum, 0.1% Triton X-100 in PBS). The anti-OCT-4 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was diluted in blocking buffer at 1:100 and applied for 1 h at room temperature or overnight at 4 °C. Secondary antibodies conjugated to Alexa fluorophores (Molecular Probes) were diluted at 1:500 in blocking buffer and applied for 1 h at room temperature. Cells were washed twice and incubated with 4′,6-diamidino-2-phenylindole (10 μg/ml) before viewing. Fluorescent images were visualized using a fluorescence microscope (Nikon Eclipse, TE2000-S) with ×20/0.40 and ×40/0.60 objectives at room temperature and captured using a Qimaging (Retiga 1300i Fast) camera and Qcapture version 2.90.1 software. Fluorescent confocal images were visualized using an Olympus FV1000 laser-scanning confocal microscope with oil objectives (×40/1.35) at room temperature and captured using Fluoview acquisition software. All images were prepared using Photoshop 8.0 (Adobe).

Immunoblotting

After 6 h of serum starvation, ESCs were stimulated with 5 ng/ml FGF2 for 0–60 min. Thereafter, cells were lysed with radioimmune precipitation buffer, and 30 μg of whole cell lysates were resolved on 10% SDS-polyacrylamide gels, transferred onto nitrocellulose membranes, and blotted with anti-phospho-ERK1/2 (Cell Signaling Technology) and anti-ERK1/2 (Cell Signaling Technology) antibodies at 1:1000.

PCR Analysis

Total RNA was isolated using the RNeasy kit (Qiagen), and cDNA was made from 1 μg of total RNA using the SuperScript III first strand synthesis system (Invitrogen). Semiquantitative PCR was performed with the primers listed in Table 1. SYBR Green® RT-PCR was performed as described previously (22) to detect expression of Ext1, Ext2, Nanog, Brachyury, Wnt3, Nestin, and Gata-6 with the following primers: Ext1 forward, 5′-gaggagtcttgctcctcac-3′; Ext1 reverse, 5′-tgtcacagcgagaatccttg-3′; Ext2 forward, 5′-acgtcaccctgttctccatc-3′; Ext2 reverse, 5′-caatggagtgaggccagaac-3′; Nanog forward, 5′-ggactttctgcagccttacg-3′; Nanog reverse, 5′-gcttccaaattcacctccaa-3′; Brachyury forward, 5′-cctgcacattacacaccactg-3′; Brachyury reverse, 5′-atcggagaaccagaagacga-3′; Wnt3 forward, ggtggagaaacaccgtgagt; Wnt3 reverse, tgaagagcgcgtacttagcc; Nestin forward, 5′-cgtctacaggcagcgctaac-3′; Nestin reverse, 5′-atctgtcaagatcgggatgg-3′; Gata-6 forward, 5′-caggtcaagacggcctctac-3′; Gata-6 reverse, 5′-cacggaggatgtgacttcg-3′; glyceraldehyde-3-phosphate dehydrogenase forward, 5′-acgggaagctcactggcatg-3′; glyceraldehyde-3-phosphate dehydrogenase reverse, 5′-ccaggcggcacgtcagatc-3′.

HS Isolation

The HS isolation was carried out as we reported previously (28, 29). In brief, ESCs were washed with ice-cold PBS followed by lysis for 20 min in 0.1 m NaOH. The cell lysate was adjusted to pH 7.0 and then loaded onto a DEAE-Sephacel column (Bio-Rad) that had been equilibrated with equilibration buffer (20 mm sodium acetate, pH 6.0, 0.25 m NaCl). After washing with the equilibration buffer, glycosaminoglycans were eluted with elution buffer (20 mm sodium acetate, pH 6.0, 1 n NaCl). The samples were desalted in water on PD10 columns (Amersham Biosciences), followed by lyophilization, and glycosaminoglycans were subjected to digestion with 20 milliunits of chondroitinase ABC (Sigma) and reduction with NaBH₄ overnight. Following an additional desalting step, total HS was quantified using 1,9-dimethylmethylene blue (30).

Ext1^−/− ESCs Are Deficient in HS

The enzyme EXT1 functions to initiate HS biosynthesis by polymerizing the HS precursor structure. To study the role of HS in ESCs, mouse ESC lines were derived from conditionally targeted Ext1 (Ext1^flox/flox) mice following standard procedures (26, 27). The Ext1 null (Ext1^−/−) ESC lines were generated by transfecting Ext1^flox/flox ESC lines with Cre recombinase, followed by single cell cloning and PCR determination of Ext1 ablation (Fig. 1A). The PCR-identified Ext1^−/− ESCs were deficient in Ext1 transcripts but retained normal levels of Ext2 mRNA (Fig. 1B). To determine whether Ext1 ablation eliminated HS biosynthesis, Ext1^flox/flox (wild type control, designated as Ext1^+/+) and Ext1^−/− ESCs were incubated with an anti-HS antibody (H10E4), and HS chains were quantified by flow cytometry. Ext1^+/+ ESCs expressed HS abundantly on their cell surfaces. In contrast, Ext1^−/− ESCs did not display any HS expression (Fig. 1C), showing directly that Ext1 ablation completely disrupts HS biosynthesis in ESCs.

HS Is Not Required for the Maintenance of ESC Self-renewal

Growth factors, including BMP-4 and Wnt, are promoters of ESC self-renewal and are modulated by HS during invertebrate and vertebrate embryogenesis, suggesting that HS might similarly modulate BMP-4 and Wnt signaling to govern ESC self-renewal. To test this idea, we examined Ext1^−/− ESCs under long term feeder-free LIF-containing culture conditions for their capacity to give rise to undifferentiated self-renewing colonies, which generally display characteristics such as compact morphology, high AP activity, and expression of pluripotency genes. After 20 days in culture, Ext1^−/− ESC clones still retained their compact dome-shaped colony morphology typical of undifferentiated ESC colonies and were morphologically indistinguishable from Ext1^+/+ ESCs cultured under the same conditions (Fig. 2A). This result suggested that HS is dispensable for the maintenance of ESC self-renewal. We further examined ESCs for AP activity and for the expression of pluripotency genes. AP assays showed that Ext1^−/− ESC colonies display high AP activity equal to that of Ext1^+/+ ESCs (Fig. 2B). Quantification further showed that both Ext1^−/− and Ext1^+/+ ESC populations contained around 95% AP-positive colonies (Fig. 2C). Examination of Nanog, Rex-1, and Oct-4 transcripts showed that pluripotency genes were still expressed at high levels in Ext1^−/− ESCs (Fig. 2D). Immunostaining for OCT-4 further showed that OCT-4 was expressed as abundantly in Ext1^−/− ESCs as in Ext1^+/+ ESCs (Fig. 2E). Taken together, examinations of colony morphology, AP activity, and pluripotency gene expression consistently showed that Ext1^−/− ESCs retained their normal self-renewal capacity and established that HS is not required for the maintenance of ESC self-renewal.

HS Facilitates Multilineage Cell Fate Commitment

To further explore the role of HS in self-renewal, Ext1^+/+ and Ext1^−/− ESCs were cultured in varying concentrations of LIF. As expected, a decrease in LIF concentration correlated with fewer AP-positive colonies in Ext1^+/+ populations. Surprisingly, a high percentage of Ext1^−/− cell colonies remained AP-positive even under low LIF concentrations, showing that Ext1^−/− ESCs were unable to exit the self-renewal program (Fig. 3A). This was further supported by the observation that Ext1^−/− cell colonies still retained their compact morphology when LIF was present at low concentrations (data not shown). To verify that HS is required for cell fate commitment into multiple lineages, ESCs were differentiated into EBs. Ext1^+/+ EBs developed internal cavities, a process that mirrors proamniotic cavitation of postimplantation mouse embryos. In contrast, Ext1^−/− EBs failed to form cavities, showing that Ext1^−/− ESCs could not differentiate normally (Fig. 3B). During EB formation, ESCs differentiate into lineages and derivatives of all three germ layers, including endoderm, mesoderm, and ectoderm, as well as extraembryonic cell types. To determine the requirement of HS for multilineage differentiation during EB formation, transcript levels of lineage-specific marker genes and pluripotency genes were determined over the time course of EB formation. As expected, upon Ext1^+/+ EB differentiation, markers, including those of endoderm (FoxA2), early mesoderm (Brachyury and MixL1), late mesoderm (Flk-1), and extraembryonic (Gata4 and Afp) lineages, became up-regulated concomitantly with a decline in transcript levels of pluripotency genes, such as Nanog and Oct-4 (Fig. 3, C and D). In contrast, Ext1^−/− EBs retained high expression levels of Nanog and Oct-4, and none of the lineage markers were expressed (Fig. 3, C and D), indicating that Ext1^−/− ESCs failed to differentiate into multiple lineages. Taken together, these results demonstrate that HS is an essential factor for ESCs to exit from the self-renewing state and to enter multilineage cell fate commitment.

Inhibition of FGF Signaling Recapitulates the Aberrant Ext1^−/− Cell Fate Commitment

HS-binding growth factors, including FGFs, BMPs, and Wnts, are master regulators of ESC fate decisions. FGF signaling has been shown to trigger the transition of ESCs from self-renewal to lineage commitment (7), whereas BMP-4 and Wnt3 are known to promote ESC self-renewal. Our results have shown that Ext1^−/− ESCs retain normal self-renewal but fail to commit into developmental lineages, suggesting that HS deficiency may disrupt FGF signaling and, as a consequence, exhibit aberrant cell fate commitment. To test this idea, we examined whether inhibition of FGF signaling would recapitulate the Ext1^−/− phenotype. ESCs were treated with the chemical FGFR inhibitor PD173074 (PD) and examined for downstream activation of ERK1/2 and changes in colony morphology upon removal of LIF. PD treatment substantially inhibited ERK1/2 phosphorylation and shows that the MAPK pathway is directly activated by FGFs in ESCs, in accordance with other reports (Fig. 4A) (7). Examination of colony morphologies showed that mock-treated Ext1^+/+ ESCs initiated differentiation and visibly flattened out after the onset of differentiation (Fig. 4B). In contrast, PD-treated Ext1^+/+ ESCs retained their compact and dome-shaped colony morphology similar to Ext1^−/− colonies (Fig. 4B). Next, we assessed whether FGFR inhibition would delay the decline in OCT-4 and Nanog expression and suppress the expression of lineage markers. We found that OCT-4 and Nanog levels were substantially reduced in mock-treated Ext1^+/+ cells, whereas PD-treated Ext1^+/+ ESCs retained high levels of OCT-4 and Nanog that were comparable with those in Ext1^−/− ESCs (Fig. 4, C and D). Consistent with elevated transcript levels of pluripotency genes, the expression of early differentiation markers Wnt3, Brachyury, Nestin, and Gata-6 was completely suppressed by PD treatment of Ext1^+/+ ESCs. Similarly, no expression of differentiation markers was detected in Ext1^−/− ESCs in the absence or presence of PD (Fig. 4, C and D). Collectively, our results show that inhibition of FGF signaling in ESCs recapitulates the Ext1^−/− ESC lineage commitment failure, supporting our hypothesis that HS deficiency leads to defects in FGF signaling, which, in consequence, delays or blocks cell fate commitment.

HS Modulates FGF Signaling in ESCs

To directly address whether HS modulates FGF signaling in ESCs, we examined FGF-2 cell surface binding. Flow cytometry analyses detected strong cell surface binding of FGF-2 on Ext1^+/+ ESCs and no significant FGF-2 binding on Ext1^−/− ESCs, showing that HS deficiency disrupts efficient cell surface binding of FGF-2 (Fig. 5A). FGF-mediated ERK1/2 activation is the driving force behind lineage commitment (7, 31). Therefore, we tested whether activation of ERK1/2 by FGF was compromised in Ext1^−/− ESCs. Stimulation of serum-starved ESCs with FGF-2 elicited substantial phosphorylation of ERK1/2 in Ext1^+/+ cells but not in Ext1^−/− ESCs, showing directly that FGF-mediated MAPK activation is disrupted in Ext1^−/− ESCs (Fig. 5B). In further support, we found that steady-state phospho-ERK1/2 levels were consistently lower in Ext1^−/− ESCs than in Ext1^+/+ ESCs (Fig. 5C). Collectively, our data show that FGF cell surface binding and subsequent activation of the MAPK pathway are dependent on HS in ESCs.

Heparin and HS Restore Cell Fate Commitment of Ext1^−/− ESCs in a FGF Signaling-dependent Manner

Heparin is a chemical analogue of HS and is commonly used as a model molecule for biological studies of HS. Heparin is well known to function as a co-factor that facilitates FGF-FGFR interactions, thereby enhancing FGF signaling in various cell types (32, 33). To support our hypothesis that HS facilitates FGF signaling to drive ESC fate commitment, we attempted to substitute endogenous HS with soluble heparin. Heparin dose-dependently restored FGF-elicited ERK1/2 phosphorylation in Ext1^−/− ESCs (Fig. 6A). Considering that heparin is structurally different from HS in containing a higher iduronic to glucuronic acid ratio and in being more heavily sulfated compared with HS, we further tested whether endogenous HS can, like heparin, restore FGF-dependent MAPK activity. HS isolated from Ext1^+/+ ESCs was supplemented to our cell culture and increased ERK1/2 phosphorylation in Ext1^−/− ESCs (Fig. 6B). This result shows that both heparin and HS in soluble form potentiate FGF signaling of Ext1^−/− ESCs and thereby restore MAPK activity to levels comparable with those of Ext1^+/+ ESCs.

To address whether heparin/HS could restore the competence of Ext1^−/− ESCs to transit from self-renewal to differentiation, we examined OCT-4 levels upon withdrawal of LIF by immunostaining. We found that the addition of heparin as well as HS significantly reduced OCT-4 expression in Ext1^−/− ESCs to levels that were similar to OCT-4 levels of Ext1^+/+ ESCs (Fig. 6C). We further examined Ext1^−/− colony morphology and AP activity upon treatment with heparin/HS. As observed previously, Ext1^−/− ESCs plated at clonal density retained their compact dome-shaped colony morphology after 5 days of differentiation in the absence of LIF. In contrast, heparin- and HS-treated Ext1^−/− ESCs visibly flattened out and the majority of cells grew in monolayers, as did differentiated Ext1^+/+ cells (Fig. 6D). Heparin and HS treatment also resulted in loss of AP activity, suggesting that Ext1^−/− ESCs no longer self-renew. Quantification showed that the number of AP-positive Ext1^−/− colonies was reduced from 80% in the absence of heparin to around 5% in the presence of heparin. Similarly, HS reduced the percentage of AP-positive Ext1^−/− ESCs to around 15%. Collectively, our colony morphology and AP assays demonstrated that heparin restored differentiation commitment of Ext1^−/− ESCs. The heparin/HS rescue also verified that the differentiation commitment defect associated with Ext1^−/− ESCs is truly due to HS deficiency alone. Furthermore, Ext1^−/− ESCs were simultaneously treated with both heparin/HS and PD. In this case, PD inhibited both changes in colony morphology and reduction in AP activity, indicating that the heparin/HS-mediated rescue of cell fate commitment was achieved specifically through restoration of FGF signaling (Fig. 6D).

To assess whether heparin would restore lineage commitment of Ext1^−/− ESCs, we analyzed transcript levels of Nanog and early differentiation markers, including Wnt3, Brachyury, Nestin, and Gata-6. Heparin treatment resulted in reduction of Nanog levels and significant increases in differentiation markers, including Brachyury, Wnt3, and Nestin, indicating that heparin successfully restored cell fate commitment (Fig. 6E). Interestingly, only Brachyury expression was restored to that of Ext1^+/+ cells. Wnt3 and Nestin expression increased but not to levels of Ext1^+/+ ESCs, and Gata-6 expression remained unchanged, indicating that heparin only rescued cell fate commitment and not the full differentiation potential of ESCs. Inhibition of FGF signaling by PD treatment maintained high Nanog levels and suppressed the expression of differentiation markers, showing again that heparin-mediated cell fate commitment rescue was achieved via restoration of FGF signaling (Fig. 6E).

HS Enhances FGF Signaling to Inhibit Nanog Expression, Thereby Facilitating ESC Differentiation Commitment

Our results have shown that HS modulates FGF signaling to control cell fate commitment of ESCs; however, it remains unclear how FGF signaling is integrated into the intracellular core circuitry of pluripotency-associated transcription factors. The homeoprotein Nanog is a key factor in maintaining self-renewal and acts together with Oct-4 and Sox2 to establish the ESC identity (34, 35). Nanog mRNA levels remained consistently high in Ext1^−/− ESCs and may account for sustained self-renewal of Ext1^−/− ESCs. The correlation between elevated Nanog expression and defects in FGF signaling of Ext1^−/− ESCs lead us to hypothesize that the efficient down-regulation of Nanog during ESC differentiation may be directly controlled by FGF signaling. To test this hypothesis, Ext1^+/+ ESCs were differentiated in serum-free medium supplemented with FGF-4 in the absence of LIF for 24 h. Nanog mRNA levels were compared between mock- and PD-treated Ext1^+/+ ESCs. PD-treated ESCs maintained substantially higher Nanog expression compared with mock-treated cells, showing that FGF signaling directly inhibits Nanog expression (Fig. 6F). Furthermore, treatment of Ext1^−/− ESCs with heparin decreased Nanog expression, and this effect was reversed by PD treatment (Fig. 6F). These results indicate a direct correlation between cell surface HS, FGF signaling, and Nanog expression, in which HS deficiency in Ext1^−/− ESCs disrupts FGF signaling and results in elevated Nanog expression levels in Ext1^−/− ESCs. Enhanced Nanog expression retains self-renewal and inhibits cell fate commitment of ESCs (34, 35). Therefore, these observations indicate that HS enhances FGF signaling, which in turn inhibits Nanog expression, thereby facilitating the transit of ESCs from self-renewal to cell differentiation commitment.