Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Feb 10.
Published in final edited form as: Mol Cancer Res. 2009 Feb 10;7(2):221. doi: 10.1158/1541-7786.MCR-08-0229

YY1 regulates the expression of snail through a distal enhancer

Matthew B Palmer 1, Parimal Majumder 1, John C Cooper 1, Hyesuk Yoon 1, Paul A Wade 2,3, Jeremy M Boss 1,3
PMCID: PMC2819842  NIHMSID: NIHMS104610  PMID: 19208738

Abstract

Expression of the snail gene is required for the epithelial-mesenchymal transitions that accompany mammalian gastrulation, neural crest migration, and organ formation. Pathological expression of snail contributes to the migratory capacity of invasive tumors, including melanomas. To investigate the mechanism of snail up regulation in human melanoma cells, a conserved enhancer located 3’ of the snail gene was analyzed. An overlapping Ets and YY1 consensus sequence, in addition to a SOX consensus sequence, were required for full enhancer activity. Proteins specifically binding these sequences were detected by EMSA. The Ets/YY1 binding activity was purified by DNA affinity chromatography and identified as YY1. Although ubiquitously expressed, YY1 was bound at the snail 3’ enhancer in vivo in snail-expressing cells but not in cells that did not express snail. Knockdown of YY1 in A375 cells led to decreased snail expression. These results identify a role for YY1 in regulating transcription of snail in melanoma cells through binding to the snail 3’ enhancer.

Introduction

Epithelial-mesenchymal transition (EMT) refers to a developmental process in which epithelial cells are converted to migratory, mesenchymal cells (1). An analogous process is postulated to occur in the progression of many epithelial cancers toward tissue invasion and metastasis (2–4). The Snail family of transcription factors plays a central role in promoting EMT in both embryonic development and cancer progression by repressing the transcription of numerous epithelial markers, most notably E-cadherin (5–7). It is therefore of significant clinical and biological interest to understand the regulation of the snail gene locus.

Snail activity is regulated at multiple levels. Nuclear localization and stability of Snail protein are positively and negatively controlled by p21-activated kinase-1 and glycogen synthase kinase-3β, respectively (8, 9). Depending on the cell type, transcription of snail is upregulated through fibroblast growth factor (FGF), hepatocyte growth factor (HGF), transforming growth factor-β(TGFβ), and integrin signaling (10–13). Increased transcription of snail is associated with activities of the transcription factors early growth response-1 (EGR1), high mobility group-A2 (HMGA2), Gli1, and NF-κB (12, 14–16). However, the mechanisms by which these signaling cascades lead to increased snail promoter activity are poorly understood.

Yin yang-1 (YY1), a ubiquitously expressed transcriptional regulator with multiple reported functions and gene targets, was first identified as an activator and a repressor of the adeno-associated virus P5 promoter (17). YY1 has since been shown to activate or repress a host of genes (18–22). These apparently paradoxical reports of YY1’s activities suggest that it is the context of the specific regulatory element and YY1’s binding partners that ultimately determine the function of YY1 at a given target gene.

Increased expression of snail and associated repression of E-cadherin are thought to contribute to the invasive behavior of melanoma (23). Previous studies of the chromatin architecture at the snail locus in melanoma cells identified a conserved regulatory element located 3’ of the gene (24). This element enhanced expression of a reporter gene specifically in melanoma cells. In this study, we show that activity of the snail 3’ enhancer requires at least two sequence motifs. The first contains overlapping consensus sequences recognized by Ets1 and YY1 transcription factors. The second motif is similar to the SOX (Sry-related HMG box) family consensus sequence. These motifs are identical in mouse and human genomes. Protein complexes bound these sites in a sequence-specific manner in vitro. Using DNA-affinity chromatography, one of these activities was purified and identified as the protein YY1. Chromatin immunoprecipitation (ChIP) confirmed binding of YY1 to the snail 3’ enhancer in snail expressing cells. Expression of snail was decreased by siRNA-mediated knock-down of YY1. These data indicate that full expression of snail in melanoma cells involves the binding of multiple factors, including YY1, to the snail 3’ enhancer.

Results

Ets/YY1 and Sox related sequence elements are required for activity of the snail 3’ element

A regulatory element located 3’ of the human snail gene was identified through DNAse hypersensitivity and reporter assays (Figure 1A and (24)). In agreement with our previous work (24), this element enhanced expression of a reporter in A375 melanoma cells (Figure 1B). 3’ regulatory element dependent expression was not observed in Raji B cells (Figure 1B) or in HaCat cells (data not shown); cells that do not express snail (Figure 1C). Consistent with the orientation-independence of enhancers, the full length KpnI fragment (1–859) encompassing the 3’ enhancer (Figure 1A) activated the reporter in either orientation (Figure 1B). Along with the high levels of snail gene expression in A375 cells (Figure 1C and (24)), these data suggest that A375 could be used as an effective model cell line to explore the mechanism of action of the 3’ element.

Figure 1. The snail 3’ enhancer requires consensus binding sites for Ets/YY1 and SOX transcription factors for full activity.

Figure 1

Open in a new tab

(A) Diagram of the human snail locus. Blocks represent exons, and arrowheads represent DNAse hypersensitive sites present in A375 cells. An 859-bp KpnI fragment encompassing the 3’ hypersensitive site was defined as the full-length enhancer. (B) Reporter constructs containing the full length 1–859 enhancer in either orientation or the minimal enhancer (294–527) were cloned upstream of the snrpn promoter and used to transfect A375 or Raji cells. Mutations at Ets/YY1 and SOX motifs were created with 6-bp of the consensus sequence altered to an XhoI site. The results are expressed as fold luciferase activity over the snrpn promoter alone, and represent the average of two experiments +/− standard deviation. Cells were co-trasfected with pRL-TK to control for transfection efficiency. (C) Real-time RT-PCR for snail mRNA was performed on RNA isolated from A375, Colo829, MDA-MB-435S, MCF-7, Raji, and HaCat cells. These results were normalized to 18s RNA, which did not differ significantly between cell types. The real-time RT-PCR results represent averages of three experiments +/− standard error.

To identify DNA-binding transcription factors mediating the 3’ enhancer’s activity, we searched the sequence for potential transcription factor binding sites using MatInspector (25). Two candidate sites were chosen based on the expression of their cognate transcription factors in neural crest tissue, where snail is also expressed: an Ets consensus site overlapping a YY1 site, and a SOX consensus site. Alignment of the human and mouse genomes showed these two sequences to be identical between the two species (Supplemental Figure 1). To determine whether these sequences were required for enhancer activity, mutations of each sequence were introduced into a reporter construct containing the 3’ element upstream of a heterologous promoter (Figure 1B). Wild-type and mutant reporters were tested for their activity following transient transfection of A375 cells. The wild-type minimal 3’-element (294–527) retained complete activity of the full-length fragment. Compared to the wild-type minimal enhancer, mutation of either the putative Ets/YY1 or the SOX sites reduced reporter expression substantially, while mutation of both sites further diminished the reporter’s enhancer activity. These results indicate that full activity of the snail 3’ enhancer requires both Ets/YY1 and SOX putative binding sites and implicates transcription factors of these families in mediating enhancer function.

Protein complexes specifically bind Ets/YY1 site in vitro

To obtain biochemical evidence for protein factors binding the snail 3’ element, EMSAs were performed (Figure 2). An oligonucleotide probe encompassing the putative Ets/YY1 site was incubated with crude nuclear extracts prepared from A375 cells. EMSAs revealed two major shifted bands. Both complexes were competed by an excess of unlabeled wild-type competitor DNA, but not by DNA carrying mutations in both the putative Ets and YY1 binding sites. Mutant competitor DNAs in the Ets (mut-1) or YY1 (mut-2) sequences failed to compete for protein binding that formed the upper (lane 4) and lower (lane 5) bands, suggesting that the upper and lower bands represent Ets and YY1 containing complexes, respectively. Thus, A375 nuclear extracts contain at least two complexes that specifically bind the Ets/YY1 sequence motif in vitro.

Figure 2. Sequence-specific binding of proteins to the Ets/YY1 site in vitro.

Figure 2

Open in a new tab

EMSAs were conducted using crude nuclear extracts prepared from A375 cells incubated with a labeled probe encompassing the consensus Ets/YY1 site as illustrated in the schematic of the minimal 3’ element. 100-fold excess of unlabeled competitor DNA was included in the DNA competition experiments as indicated. Mutant competitor DNA consisted of sequence identical to the labeled probe but bearing scrambled mutations (underlined lower case lettering) at the Ets (mut-1), YY1 (mut-2), combined Ets/YY1 (mut-3) site, or irrelevant site (mut-4) used as a negative control. Arrowheads a and b designate the two specific complexes.

Purification and identification of Ets/YY1 binding activity

To identify the proteins binding the Ets/YY1 DNA probe, a biochemical purification strategy coupled with the EMSA was employed. Nuclear extracts from A375 cells were prepared on a large scale and applied to a series of ion exchange columns (Figure 3A). Proteins were eluted from each column with a salt gradient and subjected to EMSA analysis to identify fractions containing the Ets/YY1 DNA binding activity. The final purification step consisted of two sequential DNA-affinity columns. To remove nonspecific DNA binding activities, the first DNA affinity column contained concatamerized repeats of the Ets/YY1 mutated EMSA competitor sequence. The unbound flow-through from this column was then applied to sepharose coupled to the concatamerized wild-type EMSA probe sequence. Step-wise elution from the final DNA affinity column revealed fractions enriched for the lower of the two EMSA activities (Figure 3B); the upper activity did not purify through this approach. Proteins contained in the peak fractions from each purification step were visualized by Coomassie Blue stained SDS-PAGE (Figure 3C). Bands co-eluting with EMSA activity from the final DNA column were excised from the gel and identified by mass spectrometry as hnRNPU, ILF3, and YY1. Other bands present in the affinity-purified sample were not excised and sequenced because their elution profile across the specific DNA-affinity column did not coincide with peak EMSA activity (data not shown).

Figure 3. Biochemical purification of YY1 EMSA activity.

Figure 3

Open in a new tab

(A) Diagram showing the purification scheme. Crude nuclear extract prepared from A375 cells was fractionated over a series of columns as shown. For heparin, HiTrap Q and HiTrap S columns, elution was by a gradient of increasing [NaCl] from 0.1 to 1.0 M. A mutant DNA affinity column consisting of concatamerized Ets/YY1 EMSA probe bearing a mutation in the Ets/YY1 site was employed to remove non-specific DNA-binding activities. Flow- through from the mutant DNA affinity column was applied to the wild-type DNA affinity column, followed by step elution in 0.1, 0.2, and 0.5 M NaCl. (B) EMSAs were performed on fractions from each column. Fractions containing peak EMSA activity (asterisks) were pooled and applied to the next column. (C) Fractions containing peak EMSA activity from each column were subjected to SDS- PAGE and Coomassie staining. Three purified bands were excised, digested with trypsin and analyzed by mass spectrometry. These bands were identified as hnRNPU, ILF-3, and YY1. The remaining bands were not identified because fractions containing peak quantities of these species did not precisely coincide with peak EMSA activity.

YY1 binds the Snail 3’ enhancer

To determine which of these candidate proteins represented the Ets/YY1 EMSA binding activity, antisera against each candidate were used in EMSA supershift analysis (Figure 4). The YY1 antibody supershifted (arrowheads) the strong lower complex (*), whereas the other antibodies had no effect in this assay. Recognition of the EMSA activity by the YY1 antibody, in addition to dependence of EMSA activity on a YY1 sequence described in Figure 2, demonstrates that YY1 binds the Ets/YY1 sequence in vitro.

Figure 4. YY1 binds to the snail 3’ enhancer in vitro.

Figure 4

Open in a new tab

EMSA and antibody supershift assays were performed using A375 nuclear extracts incubated with the Ets/YY1 probe as in Figure 2. Antisera were included in the reactions as indicated and demonstrated specific binding and supershifting (arrowhead) of the lower band (*).

ChIP assays were used to determine whether YY1 binds the active 3’ element in the context of cellular chromatin. In A375 cells, YY1 antisera immunoprecipitated significantly more 3’ element DNA than a control locus 5 kb upstream of the snail gene (HS1) (Figure 5). In addition to A375 cells, three other cell lines were examined for YY1 binding to the 3’ enhancer: Colo829, MDA-MB-435S, and MCF-7. Colo829 and MDA-MB-435S are melanoma derived cell lines (26) and express snail; whereas MCF-7, a breast adenocarinoma line (27) do not express snail (Figure 1C). MCF-7 were chosen as a negative control because they do not express snail. Like A375 cells, both snail expressing cell lines displayed specific binding of YY1 to the 3’ enhancer but not to the control HS1 site. MCF-7, Raji and HaCat cells, which also do not express snail or use the 3’ enhancer did not bind YY1 by ChIP (Figure 5 and data not shown). Control antisera against HIF-1α did not immunoprecipitate 3’ enhancer or HS1 DNA in any of the assays, showing that recovery of snail 3’ enhancer DNA is specific to YY1 antibody. These results demonstrate that YY1 is able to bind the snail 3’ enhancer both in vitro and in vivo.

Figure 5. YYI binds to the snail 3’ enhancer in vivo.

Figure 5

Open in a new tab

ChIP assays with A375, Colo829, MDA-MB-435S or MCF-7 cells were performed using antisera against YY1 and HIF-1α as a control, or against histone H3K27me3. Immunoprecipitated DNA was normalized to amount of input and amplified by real-time PCR using primers specific for the snail 3’ enhancer or HS1, a control locus located ~5 kb upstream of the snail gene. Results are expressed as fold over an irrelevant antibody against T-cell receptor, and represent averages of three experiments +/− standard error.

As YY1 expression was found in all of the cell types examined (Figure 6A), one reason for its inability to bind to the 3’ enhancer in the MCF-7 cells was the possibility that the locus itself may be refractory to binding due to repressive histone modifications. To investigate this possibility, ChIP assays were conducted with antibodies to histone H3 trimethyl lysine 27 (H3K27me3), a mark associated with gene silencing and the binding of the polycomb protein repressive complex (28). The results of this assay showed a strong association of this repressive mark with the 3’ enhancer only in MCF-7 (Figure 5). H3K27me3 levels were also found upstream of the snail gene in MCF-7, suggesting that the locus was repressed epigenetically (Figure 5).

Figure 6. YY1 is required for full expression of snail in A375 cells.

Figure 6

Open in a new tab

(A) Snail mRNA levels in A375 cells treated with pooled siRNAs for YY1 or control siRNA. Quantification was performed using real-time RT-PCR and normalized to actin mRNA (top panel). Results represent the average of three experiments +/− standard deviation (p<0.02 by student’s T test). Western blot (bottom panel) showing relative levels of YY1 in various cell lines, including A375 treated with for YY1 or control siRNAs. (B) Cells infected with lentivirus expressing shYY1 RNAs were assayed for snail, slug, NuBP1, and gapdh mRNA by real-time RT-PCR and for YY1, Snail, and Actin protein expression by western blotting. The RT-PCR results were normalized to the levels of 18s RNA, which did not vary significantly between experiments. RT-PCR results represent the average of six experiments +/− standard error (p value determined by student’s T test). * represent p values <0.01 compared to control.

YY1 is necessary for full expression of snail

Mutation of the Ets/YY1 binding site decreased activity of the snail 3’ element in reporter assays (Figure 1), suggesting that YY1 binding to the enhancer contributes to transcriptional enhancement of snail. To test this possibility, the affect of transient siRNA knockdown of YY1 protein in the expression of snail was examined in A375 cells (Figure 6A). Consistent with this hypothesis, siRNA-mediated knock-down of YY1 expression using a pool of siRNA oligonucleotides on A375 cells decreased snail transcript levels, while control siRNA treatment had no effect. YY1 protein levels for the YY1-siRNA and control siRNA oligonucleotides indicate that YY1 levels are substantially and specifically reduced. A similar set of results was obtained when lentivirus vectors expressing short hairpin RNAs to YY1 were used (Figure 6B and C), indicating that multiple siRNAs could knock down YY1 expression. Although a slight increase in expression was observed for some control genes, a decrease in expression to the same degree as the snail gene was not observed. This was also found for the paralog of snail, slug. The observation that YY1 knock-down resulted in only partial reduction (40–50%) of snail expression is consistent with the reporter data (Figure 1B) showing the contribution of multiple sites to the 3’ enhancer’s function. Together, these results indicate that the snail 3’ enhancer regulates transcription of snail by binding multiple protein factors, including YY1.

Discussion

Snail is known to regulate EMT in cancer cells, causing progression to an invasive, malignant phenotype. However, the mechanisms leading to activation of snail expression in cancer cells have yet to be fully realized. We previously identified a 3’ regulatory element that was functional in snail expressing cells but the factors responsible for that activity were not identified. Here we have taken a traditional biochemical approach to identify factors that could interact with the 3’ element and present evidence that the snail 3’ regulatory element requires the activity of at least two sequence motifs, separated by ~80 bp. One of these sequences uses the ubiquitous, multifunctional transcription factor YY1, which binds directly to the 3’ enhancer region in vitro. In vivo, YY1 binding to the 3’ enhancer is only observed in snail expressing cells. The other functional sequence identified within the 3’ enhancer contains an ACAAT motif that is often recognized by SOX family transcription factors (29).

Because YY1 is ubiquitously expressed, cell-type specificity of the snail 3’ enhancer’s activity may be conferred by several mechanisms, including posttranslational modification of YY1 (30–32). Alternatively, YY1 may require an accessible chromatin structure for binding. This latter possibility is supported in part by the observation that the snail negative MCF7 and HaCat cells expressed YY1 but did not bind YY1 at the 3’ enhancer in vivo. Moreover, repressive chromatin marks were observed at the 3’ enhancer in MCF-7 cells but not in cells that express snail.

Distinct amino acid modifications of histone tails found at gene regulatory regions correlate with gene transcription (33). Our previous examination of the histone modification status of the active snail 3’ enhancer revealed extensive modification with active acetylation and methylation marks as compared with the inactive enhancer in cells not expressing snail (24), such as MCF-7. MCF-7 cells are derived from breast cancer epithelial tissue. However, MCF-7 cells only exhibit a heightened invasive phenotype following exogenous snail expression (34). It is thus intriguing that the repressive histone modification H3K27me3 is found at the snail 3’ enhancer in MCF-7, while YY1 is not (Figure 5). These findings suggest that the histone modification environment at the snail 3’ enhancer correlates with YY1 binding, activity of expression, and possibly EMT.

Another mechanism to impart specificity to YY1 activity may be through specific interactions with other transcription factors at the 3’ enhancer. While we found that YY1 is necessary for full snail expression, it was not sufficient. Knockdown of YY1 by RNAi significantly reduced but did not eliminate snail expression. Similarly, mutations of the YY1 site in the 3’ enhancer substantially decreased luciferase activity of a reporter containing this snail control region but did not completely block this activity. This result suggests that other factors may be involved. One possibility is that YY1 transcriptional activity is aided by the presence of the factor that binds to the Sox consensus site that was also found to be important for the activity of the 3’ enhancer.

The finding of a Sox-binding element upstream of the YY1 site is reminiscent of the parietal endoderm-specific gene laminin-1 (35). A tissue-specific enhancer of laminin-1 employs the activities of YY1, Sp1, and NFY, all of which are ubiquitously expressed. Activity of the enhancer requires the cooperation of the tissue-specific factors SOX7 and SOX17 with YY1, Sp1, and NFY. The combinatorial code of this element bears some similarity to the snail 3’ element in the juxtaposition of YY1 and SOX sites and provides a precedent for interaction between YY1 and SOX proteins. Melanoma cells are derived from neural crest, where snail is also expressed (36). Therefore, SOX factors involved in neural crest development are potential candidates for partnering with YY1 at the snail 3’ enhancer. SOX5, expressed in both neural crest (37) and A375 cells, was assayed by ChIP but not found to bind the 3’ enhancer (data not shown). While several factors were purified and identified that could bind the SOX motif in the 3’ enhancer, none of these could be confirmed by ChIP or RNAi experimentation. Thus, the identity of the SOX factor remains unknown.

The EMSA analysis suggested that an Ets-like activity could contribute to the regulation of snail. However, this activity did not purify through the final column steps. Other assays testing whether several Ets family members (Ets1, ERG2/3/4) could bind to the putative sequence were carried out but did not yield a positive result (data not shown). Thus, the formal possibility that an Ets member binds adjacent to the YY1 site and contributes to YY1 specificity and activity still exists.

In Xenopus, YY1 was required for the neural crest expression of slug, a paralog of snail. Even though slug and snail are paralogs, the human slug gene contains no element with homology to the 3’ enhancer reported here. Furthermore, shRNAs to YY1 did not substantially alter the expression of slug in A375 cells, suggesting that the mechanisms regulating these genes were distinct.

If specificity of enhancer activity is provided by other factors, what function does YY1 serve at the snail enhancer? YY1 has been shown to recruit chromatin remodeling activities, including CBP/p300 acetyltransferases (20) and the arginine methyltransferase PRMT1 (38, 39). Previous examination of the histone modification status of the active snail 3’ enhancer revealed extensive modification with active acetylation and methylation marks as compared with the inactive enhancer (24). The function of YY1 in regulation of the snail gene may involve recruitment of histone modification enzymes to alter the chromatin structure of the 3’ enhancer. The finding of repressive marks in snail negative cells suggests that the recruitment of histone demethylases or the replacement of these nucleosomes also occurs upon or following activation. We previously found that the snail 3’ enhancer interacts with the 5’ regulatory region of the snail gene. Thus, an additional role for YY1 may be to aid in the formation of this complex.

Materials and Methods

Cell culture, siRNA, and real-time RT-PCR

All cell lines were obtained from American Tissue Type Culture Collection (Rockville, MD). A375 (melanoma, (40)), MDA-MB-435S (melanoma, (26)), MCF-7 (breast adenocarcinoma, (27)), and HaCat cells (human keratinocytes, (41)) were grown in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). Colo829 cells (melanoma) were grown in RPMI 1640 supplemented with 10% FBS (Hyclone). Raji cells, originally derived from a Burritt’s lymphoma (42), were grown in RPMI-1640 supplemented with 5% FBS and 5% bovine calf serum (Hyclone). For siRNA experiments, pools of four double-stranded siRNAs specific for YY1 or a control, nontargeting siRNA pool were obtained from Dharmacon, Inc. (Lafayette, CO). These siRNAs were used in transfecting A375 cells with DharmaFECT reagent (Dharmacon, Inc.). 75 nmol of siRNA was transfected per well in 6-well plates. Levels of mRNA were measured after four days. RNA was extracted from cells using Trizol (Invitrogen, Carlsbad, CA) and reverse transcribed by random priming. This cDNA was used as template in real-time PCR using an Icycler (Biorad Laboratories, Hercules, CA). Primers used for snail and actin gene specific amplification were: snail, 5’-ATCCGAAGCCACACACTG and 5’-CACTGGTACTTCTTGACATCTG; actin, 5’-CTCTTCCAGCCTTCCTTCCT and 5’-AGCACTGTGTTGGCGTACAG, respectively. Threshold cycles for snail were normalized relative to actin threshold cycles.

shRNA YY1 knockdowns

Lentiviral vector (pLKO.1) constructs containing short hairpin RNA sequences (shRNA) for YY1 and empty vector were purchased from Open Biosystems (Hunstville, AL, cat. RHS4533, oligo ID numbers TRCN0000010894, TRCN0000019895, TRCN0000019896, TRCN0000019898; represented as shYY1 1, 2, 3, and 4, respectively). Lentiviral constructs were used to transiently transfect HEK293FT packaging cells along with VSV-G pseudoviral particles. Two and three days post-transfection, virus-containing medium was collected from HEK293FT cells and filtered to remove nonadherent cells. Subconfluent A375 cells were infected by centrifugation using virus-containing medium and 8 µg/ml polybrene. Infected A375 cells were selected starting at 24 hours after initial infection using 2 µg/ml puromycin. RNA was purified from selected cells and subjected to real-time RT-PCR for snail expression as indicated above. Slug, NuBP1, gapdh, and 18S expression was also assessed by real-time RT-PCR using the following primer sequences: slug, 5’-GTCATACCACAACCAGAGATCC, 5’- GGAGGTGTCAGATGGAGGAG; NuBP1, 5’- AGTCCTGATGATGCTGTTATCTGG and 5’-GGTGTCCACAATGAGGTAGTCG; gapdh, 5’-CCATGGGGAAGGTGAAGGTCGGAGTC and 5’-GGTGGTGCAGGCATTGCTGATG; 18s, 5’- GTAACCCGTTGAACCCCATT, and 5’-CCATCCAATCGGTAGTAGCG.

Western blot analysis

A375 cells were lysed in buffer containing 150 mM NaCl, 1% NP-40, 50 mM Tris pH 8.0, 20% glycerol and normalized to total protein concentration using Bio-Rad protein assay reagent (Hercules, CA). Lysates were resolved on SDS-PAGE (12%) and transferred to PVDF membranes. Antibodies used for blotting include anti-YY1 (Santa Cruz Biotechnology, Santa Cruz, CA, cat. SC-1730), anti-Actin (Santa Cruz, cat. SC-1615), and anti-Snail (Abcam Inc., Cambridge, MA, cat. ab17732).

Plasmids and reporter assays

Reporter assays were performed using constructs containing the snrpn promoter driving a luciferase reporter gene in the pGL2 vector (Promega, Madison, WI) as described previously (43). The snail 3’ enhancer (233 bp) was generated by PCR, sequenced, and inserted upstream of the snrpn promoter using KpnI. Primers used to amplify the wild type enhancer were 5’-GGTACCGGCTGGGGGTGGGGGGA and 5’-GGTACCGAGCTCGACACAGTAGGCCTTCAGCTC. Mutant enhancer fragments were generated by using mutagenic primers in overlap extension PCR. Overlapping mutagenic primers were designed to substitute an XhoI site (underlined) in place of the wild type sequences for Ets/YY1 (5-AGGAAA; 5’-TTTCCTT) or SOX (5’-ACAATC; 5’-GATTGT): Ets/YY1 mutant, 5’-GAGAGATGATTCTTTCTTCTAAACCTCGAGTGGTGACCCGCAGGCCG and 5’-CGGCCTGCGGGTCACCACTCGAGGTTTAGAAGAAAGAATCATCTCTC; SOX mutant, 5’-CCCAAAAGGAAAAAAAAAAACGTTCTCTACTCGAGGCCAAATTGTGGCC and 5’-GGCCACAATTTGGCCTCGAGTAGAGAACGTTTTTTTTTTTCCTTTTGGG. These constructs were used to transfect A375 cells using Lipofectamine 2000 (Invitrogen, Inc.) or Raji cells by electroporation, along with a transfection control plasmid containing Renilla luciferase (pRL-TK). Lysates were prepared and assayed for luciferase activity using a dual luciferase assay system (Promega, Inc.).

Electrophoretic mobility shift assay (EMSA)

Nuclear extracts were prepared following the protocol of Shapiro, et al. (44). EMSA probes were prepared by annealing complementary oligonucleotides, end-labeling with γ32P-ATP, and purification by polyacrylamide gel electrophoresis. EMSA reactions (20 µl) contained 20% glycerol, 75 mM KCl, 10 mM HEPES pH 7.9, 2 mM MgCl2, 5 mM DTT, 1 µg poly(dI:dC)/poly(dI:dC), and 5 µg nuclear extract. Reactions were incubated at room temperature for a total of 45 min. After 5 min at room temperature, labeled probe was added. Antibodies used for supershift assays were added after 30 min. Reactions were run in nondenaturing polyacrylamide gel (6%) electrophoresis in glycerol tolerant buffer, and gels were dried and exposed to X-ray film. Sequences for the EMSA probe were designed as follows (Ets/YY1 homologous sites underlined): 5’-GAGAGATGATTCTTTCTTCTAAACAGGAAATGGTGACCCGCAGGCCG and 5’-CGGCCTGCGGGTCACCATTTCCTGTTTAGAAGAAAGAATCATCTCTC. Mutant oligonucleotides used in cold competition EMSAs were designed as follows (random mutations underlined, in lower case): mut-1 (Ets), GAGAGATGATTCTTTCTTCTAAACtaGtAATGGTGACCCGCAGGCCG; mut-2 (YY1), GAGAGATGATTCTTTCTTCTAAACAGGAAgctacaACCCGCAGGCCG; mut-3 (Ets/YY1), GAGAGATGATTCTTTCTTCTAAACtaGtAgtacaACCCGCAGGCCG; mut-4 (negative control), GAGAGATGActcgagCTTCTAAACAGGAAATGGTGACCCGCAGGCCG. Antibodies used for supershift experiments included anti-YY1 (Santa Cruz, cat. SC-1730x), anti-hnRNP-U (Abcam Inc., Cambridge, MA, cat. 20666), anti-ILF3 (BD Biosciences, San Jose, CA, cat. 612154), anti-Ets1 (Santa Cruz, cat. SC-350x), anti-Erg1/2/3 (Santa Cruz, cat. SC-353x), and anti-Sox5 (Santa Cruz, cat. SC-20091).

Purification of DNA binding factors

For biochemical purification of EMSA activities, A375 cells were cultured in roller bottles to obtain 280 mg of nuclear extract protein. Crude extracts were applied to a 30-ml heparin-sepharose column (BioRad) equilibrated in buffer A (20 mM Hepes pH 7.9, 100 mM NaCl, 1.5 mM MgCl2, 5 mM DTT, 10% glycerol). The column was washed with 2 column volumes of buffer A. Bound proteins were eluted with a 300-ml salt gradient (0.1 M to 1.0 M NaCl) in buffer A, and collected in 6-ml fractions. Fractions were tested for EMSA activity as described above. Fractions containing peak EMSA activity were pooled and dialyzed against buffer B (identical to buffer A but with Tris pH 7.9 rather than Hepes). This was applied to a 1-ml HiTrap Q column (Amersham Biosciences, Piscataway, NJ) equilibrated in buffer B. The column was washed with 5 ml of buffer B and eluted with a 10-ml salt gradient (0.1 to 1.0 M NaCl) in buffer B. Fractions (0.5 ml) containing peak EMSA activity were pooled, dialyzed against buffer A, and applied to a 1-ml HiTrap S column (Amersham) equilibrated in buffer A. After a 5-ml wash in buffer A, protein was eluted with a 10-ml salt gradient (0.1 to 1.0 M NaCl) in buffer A and collected in 0.5-ml fractions. Fractions containing peak EMSA activity were dialyzed against buffer A. To separate nonspecific DNA-binding activities, this material was applied to a mutant DNA-Sepharose column, consisting of concatamerized mutant EMSA probe linked to Sepharose (see below). The flow-through from this column was applied to a similar DNA column, but containing the concatamerized wild-type EMSA probe bound to Sepharose. After washing, protein was eluted in steps of 0.2, 0.3, and 0.5 M NaCl in buffer A. Purified fractions were separated by SDS-PAGE and stained with Coomassie blue. Bands were excised and submitted to the Emory Microchemical Core Facility for mass spectrometric analysis.

Preparation of DNA affinity resin

DNA affinity columns were prepared following previously described procedures (45). Briefly, complementary oligonucleotides representing the wild-type or mutant Ets/YY1 EMSA probe sequence, with the addition of a 5’ overhang sequence GATC, were annealed and phosphorylated. After extraction in phenol:chloroform and precipitation with ammonium acetate and isopropanol, the double-stranded oligonucleotides were ligated at room temperature overnight using T4 DNA ligase (New England Biolabs. Inc., Ipswich, MA). Successful ligation was verified by visualizing the products by ethidium bromide staining after polyacrylamide gel electrophoresis. Average size of ligation products was ~10-mers. Products of ligation were phenol:chloroform extracted and ethanol precipitated. This DNA was resuspended in water and added to CNBr-activated Sepharose (Amersham) in 10 mM sodium phosphate buffer (pH 8.0), and rotated overnight at room temperature. The resin was washed in water and incubated in 1 M ethanolamine (pH 8.0) for 4 hr at room temperature. Resin was washed in water, followed by 0.1 M sodium phosphate (pH 8.0), and finally 1 M KCl. The resin was then stored in 10 mM Tris (pH 8.0), 1 mM EDTA, 0.3 mM KCl at 4°C.

Chromatin immunoprecipitation

ChIP assays were performed as described (46). Cells were cross-linked in 1% formaldehyde for 10 min, washed in PBS, and lysed in buffer containing 1% SDS. The resulting chromatin was sonicated to an average length of 400 bp. To remove nonspecific binding to beads, chromatin was incubated for 1 hr with protein A agarose beads. After centrifugation, 10 µg of anti-YY1 (Santa Cruz, cat. SC-1703x), anti-HIF-1α (BD Biosciences, Inc., cat. 610958), or anti-histone H3K27me3 (Abcam, cat. Ab6002) or anti-T-cell receptor antibody was added to supernatant and rotated overnight at 4°C. Protein A beads were added and samples rotated for 1 hr. After extensive washing, immunoprecipitated chromatin was eluted in 1% SDS and incubated overnight at 65°C to reverse formaldehyde crosslinks. Samples were phenol:chloroform extracted, ethanol precipitated, and resuspended in water. Immunoprecipitated DNA was amplified and quantified by real-time PCR in an I-cycler (Biorad Laboratories, Inc.) using a 5-point genomic DNA standard curve. Primers used in real-time PCR for the HS1 and 3’ element were 5’-CCATACAATGAATAGTCCGCATCC and 5’-GAACCTCCACACTAACCTACACC; and 5’-GAGCAGCCCTTAATGACTTG and 5’-CCCAACTCCCTAACTTCCC, respectively.

Sequence alignment

Alignment of human and mouse genomes at the snail locus was performed by Genome Bioinformatics Group at UCSC. These alignments make use of the Blastz (47) algorithm and are made available at the UCSC Genome Browser (48) at http://genome.ucsc.edu/.

Supplementary Material

supplement. Supplemental Figure 1. Sequence alignment of the snail 3’ element.

The minimal enhancer fragment (294–527) sequence was aligned from human and mouse genomes. Stars depict identical bases between the two species. Boxes show consensus binding sites for Ets/YY1 and SOX factors.

Acknowledgements

The authors wish to acknowledge Jinji Jin, Yong Cai, and Joan Conaway for collaborative investigations related to this work. We thank the members of the Boss and Wade laboratories for their technical and intellectual contributions. This work was supported, in part, by the Intramural Research Program of the NIEHS, NIH (ZO1ES101965 to PAW) and by a grant from NIDDK (DK065961 to JMB).

References

  • 1.Greenburg G, Hay ED. Epithelia suspended in collagen gels can lose polarity and express characteristics of migrating mesenchymal cells. J Cell Biol. 1982 Oct;95(1):333–339. doi: 10.1083/jcb.95.1.333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Elloul S, Elstrand MB, Nesland JM, Trope CG, Kvalheim G, Goldberg I, et al. Snail, Slug, and Smad-interacting protein 1 as novel parameters of disease aggressiveness in metastatic ovarian and breast carcinoma. Cancer. 2005 Apr 15;103(8):1631–1643. doi: 10.1002/cncr.20946. [DOI] [PubMed] [Google Scholar]
  • 3.Miyoshi A, Kitajima Y, Kido S, Shimonishi T, Matsuyama S, Kitahara K, et al. Snail accelerates cancer invasion by upregulating MMP expression and is associated with poor prognosis of hepatocellular carcinoma. Br J Cancer. 2005 Jan 31;92(2):252–258. doi: 10.1038/sj.bjc.6602266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ding JX, Feng YJ, Yao LQ, Yu M, Jin HY, Yin LH. The reinforcement of invasion in epithelial ovarian cancer cells by 17beta-Estradiol is associated with up-regulation of Snail. Gynecol Oncol. 2006 Jun 23; doi: 10.1016/j.ygyno.2006.04.023. [DOI] [PubMed] [Google Scholar]
  • 5.Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, et al. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol. 2000 Feb;2(2):76–83. doi: 10.1038/35000025. [DOI] [PubMed] [Google Scholar]
  • 6.Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, et al. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol. 2000 Feb;2(2):84–89. doi: 10.1038/35000034. [DOI] [PubMed] [Google Scholar]
  • 7.De Craene B, Gilbert B, Stove C, Bruyneel E, van Roy F, Berx G. The transcription factor snail induces tumor cell invasion through modulation of the epithelial cell differentiation program. Cancer Res. 2005 Jul 15;65(14):6237–6244. doi: 10.1158/0008-5472.CAN-04-3545. [DOI] [PubMed] [Google Scholar]
  • 8.Yang Z, Rayala S, Nguyen D, Vadlamudi RK, Chen S, Kumar R. Pak1 phosphorylation of snail, a master regulator of epithelial-to-mesenchyme transition, modulates snail's subcellular localization and functions. Cancer Res. 2005 Apr 15;65(8):3179–3184. doi: 10.1158/0008-5472.CAN-04-3480. [DOI] [PubMed] [Google Scholar]
  • 9.Zhou BP, Deng J, Xia W, Xu J, Li YM, Gunduz M, et al. Dual regulation of Snail by GSK-3beta-mediated phosphorylation in control of epithelial-mesenchymal transition. Nat Cell Biol. 2004 Oct;6(10):931–940. doi: 10.1038/ncb1173. [DOI] [PubMed] [Google Scholar]
  • 10.Ciruna B, Rossant J. FGF signaling regulates mesoderm cell fate specification and morphogenetic movement at the primitive streak. Dev Cell. 2001 Jul;1(1):37–49. doi: 10.1016/s1534-5807(01)00017-x. [DOI] [PubMed] [Google Scholar]
  • 11.Peinado H, Quintanilla M, Cano A. Transforming growth factor beta-1 induces snail transcription factor in epithelial cell lines: mechanisms for epithelial mesenchymal transitions. J Biol Chem. 2003 Jun 6;278(23):21113–21123. doi: 10.1074/jbc.M211304200. [DOI] [PubMed] [Google Scholar]
  • 12.Grotegut S, von Schweinitz D, Christofori G, Lehembre F. Hepatocyte growth factor induces cell scattering through MAPK/Egr-1-mediated upregulation of Snail. Embo J. 2006 Aug 9;25(15):3534–3545. doi: 10.1038/sj.emboj.7601213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tan C, Costello P, Sanghera J, Dominguez D, Baulida J, de Herreros AG, et al. Inhibition of integrin linked kinase (ILK) suppresses beta-catenin-Lef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC−/− human colon carcinoma cells. Oncogene. 2001 Jan 4;20(1):133–140. doi: 10.1038/sj.onc.1204052. [DOI] [PubMed] [Google Scholar]
  • 14.Thuault S, Valcourt U, Petersen M, Manfioletti G, Heldin CH, Moustakas A. Transforming growth factor-beta employs HMGA2 to elicit epithelial-mesenchymal transition. J Cell Biol. 2006 Jul 17;174(2):175–183. doi: 10.1083/jcb.200512110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li X, Deng W, Nail CD, Bailey SK, Kraus MH, Ruppert JM, et al. Snail induction is an early response to Gli1 that determines the efficiency of epithelial transformation. Oncogene. 2006 Jan 26;25(4):609–621. doi: 10.1038/sj.onc.1209077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Barbera MJ, Puig I, Dominguez D, Julien-Grille S, Guaita-Esteruelas S, Peiro S, et al. Regulation of Snail transcription during epithelial to mesenchymal transition of tumor cells. Oncogene. 2004 Sep 23;23(44):7345–7354. doi: 10.1038/sj.onc.1207990. [DOI] [PubMed] [Google Scholar]
  • 17.Shi Y, Seto E, Chang LS, Shenk T. Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell. 1991 Oct 18;67(2):377–388. doi: 10.1016/0092-8674(91)90189-6. [DOI] [PubMed] [Google Scholar]
  • 18.Zhou Q, Gedrich RW, Engel DA. Transcriptional repression of the c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB. J Virol. 1995 Jul;69(7):4323–4330. doi: 10.1128/jvi.69.7.4323-4330.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rincon-Arano H, Valadez-Graham V, Guerrero G, Escamilla-Del-Arenal M, Recillas-Targa F. YY1 and GATA-1 interaction modulate the chicken 3'-side alpha-globin enhancer activity. J Mol Biol. 2005 Jun 24;349(5):961–975. doi: 10.1016/j.jmb.2005.04.040. [DOI] [PubMed] [Google Scholar]
  • 20.Mokrani H, Sharaf el Dein O, Mansuroglu Z, Bonnefoy E. Binding of YY1 to the proximal region of the murine beta interferon promoter is essential to allow CBP recruitment and K8H4/K14H3 acetylation on the promoter region after virus infection. Mol Cell Biol. 2006 Nov;26(22):8551–8561. doi: 10.1128/MCB.00420-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lu SY, Rodriguez M, Liao WS. YY1 represses rat serum amyloid A1 gene transcription and is antagonized by NF-kappa B during acute-phase response. Mol Cell Biol. 1994 Sep;14(9):6253–6263. doi: 10.1128/mcb.14.9.6253-6263.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lee KH, Evans S, Ruan TY, Lassar AB. SMAD-mediated modulation of YY1 activity regulates the BMP response and cardiac-specific expression of a GATA4/5/6-dependent chick Nkx2.5 enhancer. Development. 2004 Oct;131(19):4709–4723. doi: 10.1242/dev.01344. [DOI] [PubMed] [Google Scholar]
  • 23.Poser I, Dominguez D, de Herreros AG, Varnai A, Buettner R, Bosserhoff AK. Loss of E-cadherin expression in melanoma cells involves up-regulation of the transcriptional repressor Snail. J Biol Chem. 2001 Jul 6;276(27):24661–24666. doi: 10.1074/jbc.M011224200. [DOI] [PubMed] [Google Scholar]
  • 24.Palmer MB, Majumder P, Green MR, Wade PA, Boss JM. A 3' enhancer controls snail expression in melanoma cells. Cancer Res. 2007 Jul 1;67(13):6113–6120. doi: 10.1158/0008-5472.CAN-06-4256. [DOI] [PubMed] [Google Scholar]
  • 25.Quandt K, Frech K, Karas H, Wingender E, Werner T. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 1995 Dec 11;23(23):4878–4884. doi: 10.1093/nar/23.23.4878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Rae JM, Creighton CJ, Meck JM, Haddad BR, Johnson MD. MDA-MB-435 cells are derived from M14 melanoma cells--a loss for breast cancer, but a boon for melanoma research. Breast cancer research and treatment. 2007 Jul;104(1):13–19. doi: 10.1007/s10549-006-9392-8. [DOI] [PubMed] [Google Scholar]
  • 27.Brooks SC, Locke ER, Soule HD. Estrogen receptor in a human cell line (MCF-7) from breast carcinoma. J Biol Chem. 1973 Sep 10;248(17):6251–6253. [PubMed] [Google Scholar]
  • 28.Swigut T, Wysocka J. H3K27 demethylases, at long last. Cell. 2007 Oct 5;131(1):29–32. doi: 10.1016/j.cell.2007.09.026. [DOI] [PubMed] [Google Scholar]
  • 29.Denny P, Swift S, Connor F, Ashworth A. An SRY-related gene expressed during spermatogenesis in the mouse encodes a sequence-specific DNA-binding protein. Embo J. 1992 Oct;11(10):3705–3712. doi: 10.1002/j.1460-2075.1992.tb05455.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Hiromura M, Choi CH, Sabourin NA, Jones H, Bachvarov D, Usheva A. YY1 is regulated by O-linked N-acetylglucosaminylation (O-glcNAcylation) J Biol Chem. 2003 Apr 18;278(16):14046–14052. doi: 10.1074/jbc.M300789200. [DOI] [PubMed] [Google Scholar]
  • 31.Deng Z, Wan M, Sui G. PIASy-mediated sumoylation of Yin Yang 1 depends on their interaction but not the RING finger. Mol Cell Biol. 2007 May;27(10):3780–3792. doi: 10.1128/MCB.01761-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Oei SL, Griesenbeck J, Schweiger M, Ziegler M. Regulation of RNA polymerase II-dependent transcription by poly(ADP-ribosyl)ation of transcription factors. J Biol Chem. 1998 Nov 27;273(48):31644–31647. doi: 10.1074/jbc.273.48.31644. [DOI] [PubMed] [Google Scholar]
  • 33.Jenuwein T. Allis CD. Translating the histone code. Science. 2001 Aug 10;293(5532):1074–1080. doi: 10.1126/science.1063127. [DOI] [PubMed] [Google Scholar]
  • 34.Dhasarathy A, Kajita M, Wade PA. The transcription factor snail mediates epithelial to mesenchymal transitions by repression of estrogen receptor-alpha. Molecular endocrinology (Baltimore, Md. 2007 Dec;21(12):2907–2918. doi: 10.1210/me.2007-0293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Niimi T, Hayashi Y, Futaki S, Sekiguchi K. SOX7 and SOX17 regulate the parietal endoderm-specific enhancer activity of mouse laminin alpha1 gene. J Biol Chem. 2004 Sep 3;279(36):38055–38061. doi: 10.1074/jbc.M403724200. [DOI] [PubMed] [Google Scholar]
  • 36.Nieto MA, Bennett MF, Sargent MG, Wilkinson DG. Cloning and developmental expression of Sna, a murine homologue of the Drosophila snail gene. Development. 1992 Sep;116(1):227–237. doi: 10.1242/dev.116.1.227. [DOI] [PubMed] [Google Scholar]
  • 37.Perez-Alcala S, Nieto MA, Barbas JA. LSox5 regulates RhoB expression in the neural tube and promotes generation of the neural crest. Development. 2004 Sep;131(18):4455–4465. doi: 10.1242/dev.01329. [DOI] [PubMed] [Google Scholar]
  • 38.Baumeister P, Luo S, Skarnes WC, Sui G, Seto E, Shi Y, et al. Endoplasmic reticulum stress induction of the Grp78/BiP promoter: activating mechanisms mediated by YY1 and its interactive chromatin modifiers. Mol Cell Biol. 2005 Jun;25(11):4529–4540. doi: 10.1128/MCB.25.11.4529-4540.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Rezai-Zadeh N, Zhang X, Namour F, Fejer G, Wen YD, Yao YL, et al. Targeted recruitment of a histone H4-specific methyltransferase by the transcription factor YY1. Genes Dev. 2003 Apr 15;17(8):1019–1029. doi: 10.1101/gad.1068003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Giard DJ, Aaronson SA, Todaro GJ, Arnstein P, Kersey JH, Dosik H, et al. In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors. Journal of the National Cancer Institute. 1973 Nov;51(5):1417–1423. doi: 10.1093/jnci/51.5.1417. [DOI] [PubMed] [Google Scholar]
  • 41.Boukamp P, Petrussevska RT, Breitkreutz D, Hornung J, Markham A, Fusenig NE. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J Cell Biol. 1988 Mar;106(3):761–771. doi: 10.1083/jcb.106.3.761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Epstein MA, Achong BG, Barr YM, Zajac B, Henle G, Henle W. Morphological and virological investigations on cultured Burkitt tumor lymphoblasts (strain Raji) Journal of the National Cancer Institute. 1966 Oct;37(4):547–559. [PubMed] [Google Scholar]
  • 43.Fujita N, Jaye DL, Kajita M, Geigerman C, Moreno CS, Wade PA. MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell. 2003 Apr 18;113(2):207–219. doi: 10.1016/s0092-8674(03)00234-4. [DOI] [PubMed] [Google Scholar]
  • 44.Shapiro DJ, Sharp PA, Wahli WW, Keller MJ. A high-efficiency HeLa cell nuclear transcription extract. DNA. 1988 Jan–Feb;7(1):47–55. doi: 10.1089/dna.1988.7.47. [DOI] [PubMed] [Google Scholar]
  • 45.Kadonaga JT, Tjian R. Affinity purification of sequence-specific DNA binding proteins. Proc Natl Acad Sci U S A. 1986 Aug;83(16):5889–5893. doi: 10.1073/pnas.83.16.5889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Beresford GW, Boss JM. CIITA coordinates multiple histone acetylation modifications at the HLA-DRA promoter. Nat Immunol. 2001 Jul;2(7):652–657. doi: 10.1038/89810. [DOI] [PubMed] [Google Scholar]
  • 47.Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, et al. Human-mouse alignments with BLASTZ. Genome Res. 2003 Jan;13(1):103–107. doi: 10.1101/gr.809403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, et al. The human genome browser at UCSC. Genome Res. 2002 Jun;12(6):996–1006. doi: 10.1101/gr.229102. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement. Supplemental Figure 1. Sequence alignment of the snail 3’ element.

The minimal enhancer fragment (294–527) sequence was aligned from human and mouse genomes. Stars depict identical bases between the two species. Boxes show consensus binding sites for Ets/YY1 and SOX factors.

NIHMS104610-supplement-supplement.pdf (488.4KB, pdf)

RESOURCES