Nesprin 1 is critical for nuclear positioning and anchorage

Generation of Nesprin 1 knockout mice

To study the in vivo function of Nesprin 1, we generated Nesprin 1-deficient mice by gene targeting. The two published Nesprin 1 mutant mice were generated either by partially removing (24) or completely replacing (25) the last Nesprin 1 exon which encodes the KASH domain. Since it has been shown that there are Nesprin 1 splicing isoforms without the KASH domain (26), and to ensure that all isoforms of Nesprin 1 containing C-terminal domains (5) would be ablated, a construct was designed to target a C-terminal exon that is shared by all Nesprin 1 isoforms containing the C-terminal SR region with or without KASH domain (Supplementary Material, Fig. S1A and S2). The targeted exon was the 16th exon as counted backward from the last exon. The 16th exon is the second coding exon of Nesprin-1α (also named syne 1A, myne-1), which is highly expressed in cardiac and skeletal muscle (17,27,28) (also see Supplementary Material, Fig. S2A). After electroporation of the targeting vector into R1 embryonic stem (ES) cells, two clones that had undergone homologous recombination were identified by Southern blot analysis (Supplementary Material, Fig. S1B). The clones gave rise to chimera mice that were then bred with Black Swiss mice to generate germ line-transmitted heterozygous Nesprin 1^f/+ mice. These mice were subsequently mated with Protamine-Cre mice (29) to generate heterozygous Nesprin 1^{f/+, C/+} mice, which were then crossed with Black Swiss mice to generate Nesprin 1^+/− mice.

The heterozygotes were used as breeders to generate Nesprin 1^−/− mice and Nesprin 1^+/+ littermates for experiments. To verify that homozygous knockout mice were null mutants, we performed RT–PCR analysis with mRNA samples from wild-type and mutant mice. RT–PCR of sequences between the 18th and 13th exons (as counted backward from the last exon) was performed. Whereas the expected 787 bp product was amplified from the WT sample, a product of 644 bp was detected in samples from Nesprin 1^−/− mice (Supplementary Material, Fig. S1E). Sequence analysis of the aberrant PCR product revealed that it was identical to the wild-type product, except the 16th exon was missing (data not shown). Removal of the 16th exon led to a premature stop codon in the 13th exon (Supplementary Material, Fig. S2).

We then performed western blot and immunostaining analysis with a Nesprin 1 antibody generated against sequence 841-GRSTPNRQKSPRGKC-855 from Nesprin 1α (synaptic nuclear envelope 1 isoform 2, NP_071310.2) (also see Supplementary Material, Fig. S2B). Western blot results (Supplementary Material, Fig. S1D) clearly demonstrated that two protein bands, one at ∼120 kDa and one much larger than 200 kDa, are present in the wild-type samples, but are absent in the mutant samples. The 120 kDa band and the protein much larger than 200 kDa correspond to the molecular weights of Nesprin 1α (synaptic nuclear envelope 1 isoform 2, NP_071310.2) and the synaptic nuclear envelope 1 isoform 3 (NP_001073154.1), respectively. These are the only two mouse Nesprin 1 isoforms containing the C-terminal SR region and the KASH domain listed in NCBI website (http://www.ncbi.nlm.nih.gov/gene/64009?ordinalpos=6&itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum). Unfortunately there were several non-specific bands, and thus we could not unequivocally demonstrate by western blot analysis that all Nesprin 1 isoforms were ablated in our mutant mice. However, immunostaining of skeletal muscle isolated from Nesprin 1^−/− mice and wild-type littermates demonstrated that no Nesprin 1 protein was detectable in tissue from Nesprin 1^−/− mice (Supplementary Material, Fig. S1F). Taken together, our data suggest that we have successfully created a Nesprin 1 knockout mouse line (Nesprin 1^−/−) in which all isoforms of Nesprin 1 containing the C-terminal SR region with or without KASH domain were deleted.

Absence of Nesprin 1 causes post-natal lethality and growth retardation

Nesprin 1^−/− pups were born in Mendelian ratios with similar body size compared with wild-type littermates (Fig. 1A). At post-natal day 1, some Nesprin 1^−/− pups appeared weak and had little detectable milk in their stomachs, presumably reflecting an inability to suckle, whereas others were indistinguishable from their wild-type littermates. Genotyping of 87 offspring from heterozygous breeders indicated that more than 60% of the Nesprin 1^−/− pups died between post-natal days 2 and 11 (Fig. 1B). Surviving mice in this age range had 20–25% lower body weight than their wild-type littermates, likely the result of decreased milk intake caused by muscle weakness (Fig. 1C). Growth retardation was even more pronounced at the age of 21 days, when the body weight of the knockout was 33% lower than that of their wild-type littermates (Fig. 1C and D). There were no differences in survival or body mass between sexes within the knockout pups. The body weights of Nesprin 1^−/− mice surviving beyond 3 months were more variable, but were not significantly lower than the body weights of their wild-type littermates (data not shown).

Histopathological abnormalities in muscle from adult Nesprin 1^−/− mice

Frozen sections from quadriceps, gastrocnemius (Gas) and triceps muscles from Nesprin 1^−/− and wild-type littermate controls at 3 months of age (two males and two females from each group) were evaluated histologically and histochemically (Fig. 2A). No changes in myofiber size, fiber-type distribution or amounts of connective tissue were found in knockout mouse muscle compared with wild-type. Neither necrotic nor regenerating fibers were observed. However, the number of myofibers containing centralized nuclei was increased in all knockout mouse muscles analyzed and ranged from 5 to 12% compared with less than 1% in wild-type (Fig. 2B).

Nuclear positioning is defective in skeletal muscle fibers of Nesprin 1^−/− mice

To study the role of Nesprin 1 in nuclear positioning, we examined the spacing and location of nuclei in skeletal muscle fibers from the tibialis anterior (TA) muscle of 1-day-old and 4-month-old mice. Nuclei in wild-type fibers were evenly distributed across the width of the fiber and were not in close proximity to each other. On the other hand, nuclei in knockout fibers were often situated very close together, either in clusters or in lines along the length of the fiber (Fig. 3A and B). In addition, no clusters of synaptic nuclei were observed in the mutant muscle (data not shown). These observations are in agreement with the published observations of the other two Nesprin 1 mutant mice (24,25).

In skeletal muscle fibers from TAs of 4-month-old mice, quantification of clusters and lines of nuclei revealed that 40% of the nuclei in knockout fibers were part of a cluster and 11% nuclei were part a line (Fig. 3C). The remaining nuclei were irregularly spaced throughout the fiber, separate from one another. In wild-type littermates, less than 1% of nuclei outside of the neuromuscular junction were in clusters and no lines of nuclei were found.

Nuclear anchorage is disrupted in skeletal muscle fibers from Nesprin 1^−/− mice

Since previous studies revealed defective nuclear mechanics in Lamin-A/C-deficient cells, we investigated the nuclear mechanics in muscle fibers of Nesprin 1^−/− mice (30). In our first preparations of Nesprin 1^−/− glycerol-treated single fibers for nuclear mechanics testing, we observed a dramatic decrease in the number of nuclei that could be studied. Adult TA muscles were incubated for at least 48 h in a glycerol-based storage solution at −20°C to remove the sarcolemma, then single fibers were isolated and either immediately mounted on slides or subjected to a series of washes in bovine serum albumin (BSA)-based solutions at 4°C prior to mounting. Surprisingly, few nuclei remained attached in the unwashed Nesprin 1^−/− fibers, and almost no nuclei remained attached after washing, whereas in wild-type fibers, the nuclei remained attached to the myofiber (Fig. 4A, B and D). We confirmed that nuclear number was the same for wild-type and knockout fibers without glycerol treatment by counting nuclei in fibers isolated from fixed TA muscles (data not shown). To investigate this phenomenon further, we examined single fibers from muscles after only 12 h of incubation in storage solution. After the shorter incubation time, the sarcolemma was still partially intact, but had already detached from the myofibers. In knockout fibers, almost all of the nuclei had detached from the fibers along with the sarcolemma (Fig. 4C). In contrast, the nuclei were still completely secured to the wild-type myofibers (data not shown).

No difference in nuclear shape or perinuclear space in Nesprin 1^−/− mouse muscle

The first 10 nuclei (range 9–13) from cardiac and skeletal (Gas) muscles from three adult mice of each genotype (wild-type and Nesprin 1^−/−) were photographed at ×10–20 000 magnification. Negatives were first examined for evidence of an expanded perinuclear space, then for heterochromatin clumping and finally for marginal nuclear membrane profile. Ignoring nucleoli, heterochromatin was considered clumped if the normal marginal distribution just beneath the internal nuclear membrane was directed inward. The marginal nuclear membrane profile was considered abnormal if the membrane was excessively invaginated or crenated versus smooth, as in wild-type mice. When compared with wild-type nuclei, there was no difference in perinuclear space, distribution of heterochromatin or in the marginal nuclear membrane profile in cardiac or skeletal muscle from Nesprin 1^−/− mice (data not shown).

Minor changes in protein levels of Nesprin 1 binding partners in Nesprin 1^−/− tissue

To investigate whether expression levels of nuclear membrane proteins were altered in knockout mice, we performed western blot analyses of cardiac and skeletal muscle tissue from Nesprin 1^−/− and wild-type neonatal and adult mice. Blots were probed for Emerin, Lamin A/C, Lamin B1, Lamin B2, SUN1 and SUN2, as well as GAPDH as a loading control. This revealed upregulation of SUN1 in 1-day-old knockout heart as well as upregulation of SUN2 in 1-day-old knockout skeletal muscle but all other tested proteins remain unchanged in either 1-day-old knockout hearts or skeletal muscle (Fig. 5). No changes in expression levels of the tested proteins, Emerin, Lamin A/C, Lamin B1, Lamin B2, SUN1, SUN2 or Desmin were found between wild-type and knockout tissues from adult mice (data not shown).

Nesprin 1^−/− muscle fibers exhibit abnormal nuclear mechanics

Nuclear morphology and location only provide information regarding nuclear placement and structure. In order to investigate the degree of strain transmission between myonuclei and the cytoskeleton, we imaged the nuclei of knockout and wild-type single fibers during controlled deformation. The extent of fiber stretch was determined from the sarcomere length, which was measured based on immunolabeling of α-actinin, the prominent Z-disk protein. After fiber stretch over a similar sarcomere length range, both knockout and wild-type nuclei deformed linearly, but knockout nuclei deformed significantly less compared with wild-type nuclei (Fig. 6A). Nuclear aspect ratio (length divided by width) was calculated from the images at each stretch increment and normalized to initial aspect ratio. In knockout fibers, nuclear aspect ratio changed significantly less with increasing sarcomere length compared with wild-type fibers (Fig. 6B and C), indicating decreased strain transmission from perinuclear regions to the knockout nuclei.

Physiological function of skeletal muscle of Nesprin 1^−/− mice

Stress generation capacity of skeletal muscle from neonatal and 4-month-old Nesprin 1 knockout mice and their wild-type littermates was tested as described previously (31,32). Isometric stress tended to be lower at both ages, but the trend was not significant (Supplementary Material, Fig. S3A and B). In order to impose even higher stresses upon the muscles, isolated muscles from adult mice were also subjected to a bout of 10 eccentric contractions (ECs) after the initial isometric contractions. Stress generation declined during and after the bout for both genotypes, but there were no significant differences in either post-eccentric isometric stress or percent isometric stress drop (Supplementary Material, Fig. S3C). Nesprin 1^−/− muscles, however, did exhibit more variation in stress generated.

Reduced exercise capacity in Nesprin 1^−/− mice

Adult wild-type and Nesprin 1^−/− mice were subjected to daily treadmill running over a 3-week period. Average distance run (Supplementary Material, Fig. S3D) and average running time (data not shown) were both significantly lower for knockout mice compared with wild-type at 7, 14 and 21 days into exercise training.

Nesprin 1^−/− mice have normal heart function

To elucidate the underlying basis for differences in exercise capacity between genotypes, we studied the heart function of Nesprin 1^−/− mice by echocardiogram and electrocardiogram. We tested five pairs of Nesprin 1^−/− mice and wild-type littermates within the following four groups: males and females at 3, 6, 9 and 12 months of age. Parameters measured included heart rate, left ventricle mass, left ventricle internal end-diastolic dimension, left ventricle systolic dimension, left ventricle fractional shortening, left ventricle wall thickness (diastolic and systolic), PR interval and QRS duration. We did not find any significant change in these cardiac function measures between Nesprin 1^−/− mice and wild-type littermates as a function of either gender or age (data not shown).

Existence of Nesprin 1 splicing isoforms without the KASH domain in mouse brain

Over 60% of our Nesprin 1^−/− mice died perinatally, which is similar to the survival rate of Nesprin 1 mutant mice generated by Puckelwartz et al. (25), but in contrast to the normal viability of Nesprin 1 mutants generated by Zhang et al. (24). Detailed analysis of the targeting strategies utilized by the three laboratories to generate the mutant mice revealed that, owing to remaining alternative splicing sequences, Nesprin 1 splicing isoforms without the KASH domain (26) may be still intact in mutant mice generated by Zhang et al. (24), whereas the Nesprin 1 splicing isoforms without the KASH domain would be ablated in mutants generated by Puckelwartz et al. (25) and in our Nesprin 1 mutants (Supplementary Material, Fig. S2). We investigated whether there are normally mouse Nesprin 1 transcripts lacking the penultimate exon that give rise to splicing isoforms without the KASH domain, as in humans (26). RT–PCR analysis of exon inclusion in Nesprin 1 transcripts was performed on RNA from the following different organs: brain, heart, kidney, liver, lung, skeletal muscle and spleen (Fig. 7). A truncated Nesprin 1 transcript was found in the brain. Sequencing confirmed that the second-to-last exon was skipped. The skipping of the penultimate exon leads to a novel transcript which includes an 11 novel codons followed by a stop codon, to result in a putative translation product lacking the KASH domain (Supplementary Material, Fig. S2).

Gene targeting and generation of Nesprin 1 knockout mice

Nesprin 1 genomic DNA was isolated from a R1 ES cell and was used to create a Nesprin 1-targeting construct containing floxP sites and the neomycin resistance gene. The construct was generated in the pBluescript II KS+ vector, and the 5′ arm of homology consisted of a 2.75 kb NotI–SalI fragment fused with first floxP site upstream of Nesprin 1 exon 16 followed by neomycin flanked by FRT sites. The 3′ arm of homology was a 2.92 kb SalI–KpnI fragment located downstream of second floxP site (Supplementary Material, Fig. S1A). The targeting construct was verified by sequencing and linearized with NotI before electroporation into R1 ES cells at the Transgenic Core Facility at the University of California, San Diego. Seven hundred G418-resistant ES clones were screened for homologous recombination by Southern blot analysis as described in the following section.

Southern blot analysis

Genomic DNA was extracted from G418-resistant ES cell clones and mouse tails as previously described (42). ES cell DNA was digested with HindI and analyzed by Southern blot analysis. A 535 bp fragment was generated by PCR using mouse genomic DNA and specific Nesprin 1 primers (forward, TATACCATCAGGATTGGTTTCATTGG; reverse, ACTACGTCCTGGTCCAGGAAACATG). The PCR product was subsequently radiolabeled using α-[³²P]dCTP by random priming (Invitrogen). DNA blots were hybridized with the radiolabeled probe and visualized by autoradiography. The wild-type allele is represented by a band of 9.2 kb, whereas a band of 5.2 kb represents the correctly targeted mutant allele.

Generation and genotyping of mice

Two independent homologous recombinant ES clones were microinjected into blastocysts from C57/B6 mice at the Transgenic Core Facility at the University of California, San Diego. Male chimeras were inbred with female Black Swiss mice to generate germ line-transmitted heterozygous mice (Nesprin 1^+/−). Nesprin 1^+/− mice were subsequently intercrossed to generate homozygous null mutant mice (Nesprin 1^−/−).

Offspring were genotyped by PCR analysis using mouse tail DNA and wild-type (forward, TGGTAGTCATCAAGATGCTGGCTTGGG; reverse, CTTTCTAAGTCTACAGTGGTGGGCTC) and knockout allele-specific primers (forward, GTAATATTTGTGGGACCGAGTTCTCTGAG, reverse primer is the same as wild-type).

Total protein extracts were prepared from post-natal TA muscle separated on a 4–15% Ready Tris–HCl gel (BioRad) and subjected to western blot analysis using polyclonal antibody against sequence 841-GRSTPNRQKSPRGKC-855 from Nesprin 1α (synaptic nuclear envelope 1 isoform 2, NP_071310.2). Glyceraldehyde-3-phosphate dehydrogenase (GADPH) antibody was used for normalization (1:10 000, Sigma-Aldrich).

Single fiber isolation and staining

To obtain a large number of fine single myofibers, TA muscles were fixed with 4% paraformaldehyde (PFA) for more than 2 days. Fixed muscles were divided into several bundles by pulling the tendon with tweezers, and non-muscle tissue was removed to the greatest degree possible under a binocular microscope. The muscle bundles were macerated in 40% NaOH solution for 3 h at room temperature and then shaken for 5–10 min to separate the bundle into single myofibers. Isolated myofibers were rinsed twice with phosphate-buffered saline (pH 7.3) for neutralization. They were then mounted in mounting medium with DAPI (Vector, H1200).

Myofibers were also isolated from glycerol-extracted muscle: TA muscles were dissected from the bone and soaked overnight in 50% glycerol diluted with calcium-chelated saline at 4°C, and the myofibers were then mechanically isolated from the muscle tissue with sharpened fine tweezers under a dissecting microscope. These mechanically isolated single myofibers were also fixed with calcium-chelated 4% PFA before being mounted on a glass slide in mounting medium with DAPI (Vector, H1200).

RT–PCR

Total RNA was extracted from 1-month-old wild-type mouse tissues using a standard Trizol RNA isolation protocol (Invitrogen). The first strand was generated by SuperScript First Strand Synthesis System (Invitrogen). PCR was performed using primers located in the third-from-last and last exon (P1, GTCCCACATCCGGAAGAAGTACCCC and P3, CTTCAGAGTGGAGGAGGACCGTTGG) and 17th and 13th exon (P17, GAGAACAAAATCCAGCTTCAGGAAATGGGAG and P13, GTAGGTCGTCCCATCTCTGGTTGCC). The amplified samples were run on an agarose gel and the results were confirmed by sequencing.

Immunostaining

Hindlimbs from post-natal day 1 mice were fixed overnight in 4% PFA in either an unstretched or stretched position as described by Bang et al. (43). The TA was dissected out and incubated in 10, 15 and 30% sucrose in PBS before freezing in optimal cutting temperature. Ten micrometer cross frozen sections were permeabilized and blocked in 5% normal goat serum, 0.3% Triton X-100, 5% BSA (Sigma-Aldrich) in 1× PBS for 2 h, followed by incubation overnight at 4°C in a humidified chamber with sarcomeric α-actinin antibody (1:500; Sigma-Aldrich) in blocking buffer. After rinsing in wash buffer (1×PBS with 0.3% Triton X-100), sections were incubated at room temperature for 2 h with fluorescently labeled secondary antibodies (1:100 goat anti-mouse cy3) in blocking buffer. Slides were rinsed in wash buffer and mounted in mounting buffer with DAPI (Vector Laboratory, H1200).

In the adults, TA muscles were dissected and frozen in isopentane pre-cooled in liquid nitrogen for 45 s and then stored at −80°C. Cryostat sections (10 μm) were cut and fixed by acetone at −20°C for 10 min. After permeabilization with washing buffer, slides were blocked in blocking buffer described in previous section for 2 h and then incubated with the following antibodies: anti-SUN1 (1:150, kindly provided by Dr Sue Shackleton, University of Leicester, University Road, UK), anti-SUN2 (1:100, kindly provided by Dr Didier Hodzic, Washington University School of Medicine, St Louis, MO, USA), anti-Lamin A/C (1:1000, kindly provided by Dr Larry Gerace, Scripps Research Institute, La Jolla, CA, USA), anti-Nesprin 1 (1:100), anti-Emerin (1:100, Santa Cruz) and anti-Desmin (D33; 1:25; Sigma-Aldrich). After rinsing in wash buffer, sections were incubated at room temperature for 2 h with fluorescently labeled secondary antibodies (1:100 goat anti-mouse cy3, 1:100 goat anti-rabbit cy2 or cy3, 1:50 goat anti-guinea pig FITC) and DAPI in blocking buffer. Finally slides were mounted in mounting media (Dako S3023). Confocal microscopy was performed using a confocal microscope (FluoView, Olympus) with a 40× (NA 1) plan-apochromat oil objective. Individual images (1024 × 1024 dpi) were converted to tiff format and merged as pseudocolor RGB images using ImageJ (NIH).

Exercise

Six pairs of 4-month-old Nesprin 1^−/− mice and wild-type littermates were subjected to 3 weeks of daily treadmill exercise (Model: Exer-6M Treadmill with Treadmill Shock Detection Unit). Mice were placed in their respective lanes with the shocking apparatus turned off and allowed to adjust to the surroundings for 15 min. During the adjustment period, the treadmill was set to 0.3 m/s, and the mice were trained to run with gentle prodding for 2 h every day. The treadmill incline was set to 25° at all times. Exercise capacity was assessed by daily treadmill run to exhaustion. At regular intervals, the speed of the treadmill was ramped up every 3 min from the initial 0.23 to 0.32 m/s in 0.03 m/s steps. Then the speed was increased from 0.35 to 0.41 m/s in 0.03 m/s steps every 20 min. The speed was then returned to 0.35 m/s and held there until exhaustion, defined as inability to continue running despite gentle prodding.

Histopathology and ultrastructural analysis

Muscle specimens (cranial tibial, Gas, quadriceps and triceps) from 4-month-old knockout and wild-type mice were collected immediately following euthanasia. Specimens were flash frozen in isopentane pre-cooled in liquid nitrogen and stored at −80°C until further processed. Cryostat sections (8 μm) were cut then stained by a standard panel of histochemical stains and reactions (44). Additional muscle specimens were immersion fixed in 5% glutaraldehyde in 0.1% phosphate buffer for 24 h. Following rinses, tissues were post-fixed in 1% aqueous osmium tetroxide for 3–4 h and then dehydrated in a graded alcohol series and propylene oxide. After infiltration with a 1:1 mixture of propylene oxide and araldite resin for 4 h, muscles were placed into 100% araldite resin overnight and then embedded in fresh araldite resin. Thick sections (1 μm) were cut with glass knives and stained with Toluidine blue prior to light microscopic examination. Thin sections (60–90 nm) were cut with a diamond knife and stained with uranyl acetate and lead citrate before examination in a Zeiss 10 electron microscope.

Skeletal muscle physiology

Studies of neonatal muscle stress generation were performed as described previously (32). The Gas muscles of 1-day-old Nesprin 1^−/− mice and their wild-type littermates were used for this study. Briefly, mice were sacrificed and hindlimbs were transected at the proximal femur, carefully skinned and immersed in ice-cold mammalian Ringer solution (137 mm NaCl, 5 mm KCl, 1 mm NaH₂PO₄, 24 mm NaHCO₃, 2 mm CaCl₂, 1 mm MgSO₄, 11 mm glucose and 10 mg/l curare). The Achilles tendon was released at its calcaneal insertion and the tibia and anterior muscle compartment were carefully resected to isolate the Gas and its origin on the distal femur. The Gas was transferred to a custom-made chamber filled with Ringer solution, which has been previously described (31). To secure the muscle in the chamber, the Achilles tendon was tied to a rigid post-interfaced with a force transducer (Series 300B, Aurora Scientific, Aurora, ON, Canada) using silk sutures. The femur was secured to a post-attached to a micromanipulator. The Gas muscle length (L_m) was adjusted such that passive muscle tension was barely detectable by the force transducer. Muscles were activated by an electrical stimulator (Pulsar 6 bp, FHC, Bowdoinham, ME, USA) via platinum plate electrodes that extended across the entire Gas length. Maximum isometric force was elicited by applying a 400 ms train of 0.3 ms supra-maximal pulses delivered at 100 Hz while maintaining constant L_m. A computer algorithm in LabVIEW (National Instruments, Austin, TX, USA) was used to trigger the stimulator, acquire signals from the force transducer via a data-acquisition board sampling at 4000 Hz (PCI-6040 m, National Instruments) and analyze force–time records. After being tested, the Gas was removed from the chamber, the Achilles tendon and femoral origin were cut off and the Gas was dabbed dry and weighed.

To determine the isometric stress generated, isometric force was normalized to physiological cross-sectional area (PCSA). For computations, previously published density and architectural values for the mouse Gas were used (32,45,46).

Studies of adult skeletal muscle physiology were performed as described previously (31). Mice were sacrificed and the fifth-toe belly of the extensor digitorum longus (EDL) muscle was dissected in mammalian Ringer solution. The 5th toe EDL was then transferred to a custom chamber filled with Ringer solution. Using 8-0 silk sutures, the muscle origin was secured by the tendon at a rigid post-attached to a micromanipulator and the insertion was secured by the tendon to the arm of a dual-mode ergometer (model 300B, Aurora Scientific). Sarcomere length was measured by laser diffraction at 632.8 nm and set to 3.0 μm. Muscle length (L_m) was defined as the tendon-to-tendon distance when at a sarcomere length of 3.0 um. The EDL muscle was subjected to three passive stretches, one every 2 min, each at 10% of L_m and at a velocity of 0.7L_m/s. Maximum isometric tension was measured by applying a 400 ms train of 0.3 ms pulses delivered at 100 Hz while muscle length was held constant. This measurement was repeated twice more at 2 min intervals. The stimulation frequency chosen for these isometric contractions and the other contractions that follow was 100 Hz, as this frequency produced a fused tetanic contraction, but was low enough to prevent excessive fatigue. Selected muscles underwent 10 ECs, one every 2 min, each time stretched to 15% of L_m at the velocity of 2L_m/s. Following the EC cycle, the isometric contractions were repeated three times at 2 min intervals. Muscle weight was measured to determine the PCSA (31). Data were acquired using a CA-1000 data board and analyzed in LabVIEW 7.0 (National Instruments).

Nuclear anchorage studies

Shortly after euthanization, TA muscles were dissected from hindlimbs and placed in a glycerol-based storage solution [consisting of (mm): KPropionate 170.0, K₃EGTA 5.0, MgCl₂ 5.3, imidazole 10.0, Na₂ATP 21.2, NaN₃ 1.0, glutathione 2.5, 50 μm leupeptin and 50% (v/v) glycerol] at −20°C for at least 24 h but no more than 2 weeks. Single intact fiber segments were carefully dissected in relaxing solution [at pCa 8.0 and pH 7.1 consisting of (mm): imidazole 59.4, KCH₄O₃S 86.0, Ca(KCH₄O₃S)₂ 0.13, Mg(KCH₄O₃S)₂ 10.8, K₃EGTA 5.5, KH₂PO₄ 1.0, Na₂ATP 5.1 and 50.0 μm of the protease inhibitor leupeptin]. Fibers were then either placed directly onto glass slides and mounted with DAPI-containing Vectashield (Vector Laboratories, Burlingame, CA, USA) (unwashed group) or were transferred to a chamber where the fiber segments were secured between two stationary wires with suture loops (washed group). Segments displaying abnormal discoloration, nicks or localized swelling were discarded. The fibers in the washed group were rinsed three times using relaxing solution with 1% BSA, followed by incubation at 4–8°C with gentle agitation in 15 μl/ml normal horse serum in 0.1% BSA (15 min), 100 μl/ml normal mouse serum in 0.1% BSA (15 min) and 0.1% BSA (three washes of 5 min each). The fiber segments were then incubated with α-actinin antibody (Sigma A7811; St Louis, MO, USA) pre-conjugated to AF594 (Molecular Probes A-10239; emission = 594 nm) at 4°C overnight. After three more washes in 0.1% BSA (15 min each), fiber segments were mounted on slides with DAPI-containing Vectashield (Vector Laboratories). Slides were imaged at 10 or 20× with a Nikon Microphot-SA epifluorescent microscope (Nikon Instruments, Melville, NY, USA) and photographed with a SPOT digital camera (Diagnostic Instruments, Sterling Heights, MI, USA).

Nuclear stretch

Fibers to be used for nuclear stretch experiment were prepared in a similar way as the ‘washed’ fibers. While under anesthesia, the TA muscle was excised, then incubated in 0.1% Triton X-100 on ice for 2–4 h before proceeding with single fiber dissection. Single fiber segments were mounted in a chamber between a stationary post and a force transducer in a custom-built apparatus previously described (47). Fibers underwent the washes described above followed by an additional 30 min wash in 1.5 μl/ml DRAQ5, a far-red fluorescent DNA dye. The apparatus was then mounted on an inverted confocal microscope (LSM 510, Zeiss). Fibers were stretched just to the point where the passive force could be detected by the force transducer. At this point, the resting fiber length (L_o) was measured, the fiber diameter was measured in three different locations along the fiber, and a region of interest was identified and imaged. Fibers were then stretched in increments of 10% L_o and allowed to stress-relax for 2 min. At the end of each 2 min interval, passive force was recorded and a confocal image stack of the region of interest was taken.

Changes in nuclear shape with increasing stretch were determined from the DRAQ5 signal in the confocal images by fitting ellipses to the nuclei and recording the lengths of the major and minor axes in successive images. Sarcomere length was computed with a custom-written Matlab program from the α-actinin label in the confocal images.