Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Nov 27.
Published in final edited form as: Oncogene. 2008 Sep 8;27(56):7106–7117. doi: 10.1038/onc.2008.318

Regulation of androgen receptor transcriptional activity by rapamycin in prostate cancer cell proliferation and survival

Yu Wang 1,2, Margarita Mikhailova 3, Swagata Bose 1, Chong-Xian Pan 1,2, Ralph W deVere White 1, Paramita M Ghosh 1,2
PMCID: PMC2694040  NIHMSID: NIHMS108335  PMID: 18776922

Abstract

The mTOR inhibitor rapamycin caused growth arrest in both androgen-dependent and androgen-independent prostate cancer cells; however, long-term treatment induced resistance to the drug. The goal of the present studies was to investigate methods that can overcome this resistance. Here we show that rapamycin treatment stimulated androgen receptor (AR) transcriptional activity, whereas suppression of AR activity with the anti-androgen bicalutamide sensitized androgen-dependent, as well as AR-sensitive androgen-independent prostate cancer cells, to growth inhibition by rapamycin. Further, the combination of rapamycin and bicalutamide, but not the individual drugs, induced significant levels of apoptosis in prostate cancer cells. The net effect of rapamycin is determined by its individual effects on the mTOR complexes mTORC1 (mTOR/raptor/GβL) and mTORC2 (mTOR/rictor/sin1/GβL). Inhibition of both mTORC1 and mTORC2 by rapamycin induced apoptosis, whereas rapamycin-stimulation of AR transcriptional activity resulted from the inhibition of mTORC1, but not mTORC2. The effect of rapamycin on AR transcriptional activity was mediated by the phosphorylation of the serine/threonine kinase Akt, which also partially mediated apoptosis induced by rapamycin and bicalutamide. These results indicate the presence of two parallel cell survival pathways in prostate cancer cells: a strong Akt-independent, but rapamycin-sensitive pathway downstream of mTORC1, and an AR-dependent pathway downstream of mTORC2 and Akt, that is stimulated by mTORC1 inhibition. Thus the combination of rapamycin and bicalutamide induce apoptosis in prostate cancer cells by simultaneously inhibiting both pathways and hence would be of therapeutic value in prostate cancer treatment.

Keywords: Androgen independence, Akt, apoptosis, mTOR, raptor, rictor

INTRODUCTION

Prostate cancer is monitored by serum levels of prostate specific antigen (PSA), which is regulated by the androgen receptor (AR). It is estimated that following radical prostatectomy or radiation therapy as primary treatment, evidence of rising PSA values is observed in approximately 15–30% of patients and relates to recurrent prostate cancer, which is treated by androgen withdrawal therapy (Edwards & Bartlett, 2005). Patients respond initially to such treatment but frequently relapse, indicative of the development of androgen-independent prostate cancer (AIPC) (Petrylak, 2005). Currently the only effective treatment for patients with AIPC is the chemotherapeutic agent docetaxel, which caused a small (< 2.5 months), although significant, improvement in patient survival, compared to best standard of care (Boehmer et al., 2005; Petrylak, 2005). Studies have shown that hormonal therapy does not cause cell death, but rather results in cell cycle arrest, whereas the development of androgen independence triggers a release from that arrest, and cell cycle progression, even in the absence of androgens (Agus et al., 1999). Hence, the overall goal of this study is to identify agents that would prevent survival in AIPC cells, and to elucidate the molecular mechanisms involved.

The drug rapamycin is widely used as an immunosuppressant in renal and hepatic transplants, and is also in clinical trials for various types of cancers (Lee et al., 2007). We and others showed that rapamycin was effective in inhibiting the growth of both androgen-dependent and independent prostate cancer cells (Ghosh et al., 2005; Wu et al., 2005), and hence was promising as a new drug for the treatment of AIPC. However, in a Phase I/II clinical trial, rapamycin as monotherapy was associated with tumor regression in only 25% of patients (Sharef et al., 2006). Despite this, rising evidence points to the mTOR pathway as a major regulator of prostate epithelial cell growth and death, cell motility and angiogenesis (Cao et al., 2006; Cinar et al., 2005; Gao et al., 2003; Ghosh et al., 2005; Kremer et al., 2006; Wu et al., 2005). This warranted further investigation of rapamycin as an anti-neoplastic agent in combination studies. Here, we examined the cause for the failure of rapamycin as monotherapy and means to overcome resistance to this therapy.

In order to identify the mechanism by which prostate cancer cells develop resistance to rapamycin following long-term treatment, we investigated the effect of this drug on downstream targets. The only known target of rapamycin is mTOR (mammalian target of rapamycin). mTOR is activated downstream of the phosphatidylinositol 3-kinase (PI3K)/Akt pathway, a major regulator of cell survival in mammalian cells. Activated mTOR forms two distinct multiprotein complexes: mTORC1 consisting of mTOR, raptor, and GβL (also known as mLST8), and mTORC2 consisting of mTOR, rictor, sin1 and GβL (Sarbassov et al., 2005a). Our data shows that rapamycin inhibits both mTORC1 and mTORC2 in prostate cancer cells. Rapamycin complexes with the immunophillin FK506 binding protein (FKBP12) (Sabatini et al., 1994), and the rapamycin/FKBP12 complex can bind mTORC1 but not mTORC2 (Jacinto et al., 2004; Sarbassov et al., 2004). Hence until recently it was thought that mTORC2 is rapamycin insensitive. However, rapamycin/FKBP12 can also bind to free mTOR (Brown et al., 1994), and it has been postulated that this inhibits de novo production of mTORC2 (Sarbassov et al., 2006). mTORC1 regulates the phosphorylation of downstream targets p70S6 kinase and 4E-BP1, which regulate translation initiation (Gingras et al., 2001). On the other hand, mTORC2 has been shown to regulate Akt phosphorylation (Hresko & Mueckler, 2005; Sarbassov et al., 2005b). Thus Akt both regulates, and is regulated by mTOR.

In this paper, we show that rapamycin treatment stimulated AR transcriptional activity, whereas suppression of AR activity with the anti-androgen bicalutamide sensitized androgen-dependent, as well as AR-sensitive androgen-independent prostate cancer cells, to growth inhibition by rapamycin. Rapamycin treatment inhibited both mTORC1 and mTORC2, and inhibition of both complexes induced apoptosis, whereas rapamycin-induced AR transcriptional activity resulted from the inhibition of mTORC1, but not mTORC2. Our results indicate the presence of two parallel cell survival pathways in prostate cancer cells: a strong Akt-independent, but rapamycin-sensitive pathway downstream of mTORC1, and an AR-dependent pathway downstream of mTORC2 and Akt, that is stimulated by mTORC1 inhibition. Simultaneous inhibition of both pathways by the combination of rapamycin and bicalutamide induce apoptosis in prostate cancer cells and hence would be of therapeutic value in prostate cancer treatment.

RESULTS

Rapamycin inhibits prostate cancer cell growth but stimulates AR transcriptional activity

To evaluate the effect of rapamycin on prostate cancer cell growth, we treated AR positive LNCaP (Figure 1A) and AR negative PC-3 cells (Figure 1B) with 1 nM and 100 nM rapamycin. Both doses of rapamycin were effective in inhibiting cell growth in these cell lines (Figure 1A,B), although the effect of rapamycin in LNCaP cells (42% inhibition on day 5 with 1 nM rapamycin, p<0.001) was less compared to that in PC-3 cells (73% inhibition on day 5 with 1 nM rapamycin, p<0.0001). Since the physiological level of rapamycin achieved in patients is of the order of 1 nM (Sharef et al., 2006), all further studies, unless specified, were conducted at this concentration. Previous studies showed that rapamycin increased PSA levels in LNCaP cells (Cinar et al., 2005). However, the mechanism by which rapamycin stimulates PSA was not known. Here we show that in LNCaP cells and its AI sublines C4-2 and LNAI, rapamycin stimulated AR transcriptional activity on a human PSA promoter tagged to a luciferase construct (hPSA-luc) approximately 2–2.5-fold (p<0.001) (Figure 1C). These studies indicate that rapamycin is a good inhibitor of both AR positive as well as AR negative prostate cancer cells, but in the AR positive cells, rapamycin also induced AR transcriptional activity.

Figure 1. Rapamycin inhibits cell growth but stimulates AR transcriptional activity.

Figure 1

Open in a new tab

(A,B) Effect of rapamycin on the growth of (A) LNCaP and (B) PC-3 cells. Cells were plated in triplicate and treated with DMSO (control), 1 nM or 100 nM rapamycin. Culture medium containing the drug was replenished every alternate day. Growth rate of the cells were assessed by MTT assay over a period of 1–6 days. Data shown represent mean ± S.D. (n=3). (C) LNCaP, C4-2 and LNAI cells were co-transfected with plasmids expressing hPSA-luc and β-gal and treated with vehicle or 1 nM rapamycin. Rapamycin induced a ~2-fold increase in AR transcriptional activity in all three cell lines. Data represents mean luciferase luminescence ± S.D. (n=3) normalized to β-gal.

Rapamycin-induced AR transcriptional activity promotes growth of prostate cancer cells

As rapamycin has a greater effect on AR-negative cells compared to their AR positive counterparts, we examined whether the AR affected the response of these cells to the growth inhibitory effects of rapamycin. The AR is a transcription factor and promotes the transcription of many genes, including PSA, by binding to the androgen response element (ARE) in their promoter region. The AR has also been shown to regulate proliferation and survival in androgen-dependent prostate epithelial cells (see Supplemental Data), but the exact targets of AR in the cell cycle and survival machinery, other than p21Cip1/Waf1 (Lu et al., 1999), are not known. Studies show that low levels of AR stimulation (represented by 3–4 fold increase in PSA) increased proliferation rates in prostate cancer cells, whereas high levels of stimulation (>15-fold) were inhibitory (Supplemental data). These results indicate that although PSA itself is not a regulator of cell growth, its expression is an indicator of AR transcriptional activity on other target genes as well.

Rapamycin induced a 2-fold (100%) increase in AR transcriptional activity in both LNCaP and C4-2 cells (Figure 2A). This increase was within the stimulatory range of the effect of AR activity on cell proliferation (Supplementary Data). On the other hand, bicalutamide, a competitive inhibitor of AR ligand binding, inhibited not only basal levels of AR transcriptional activity, but also AR transcriptional activity stimulated by rapamycin (Figure 2A), resulting in suppression of rapamycin-induced PSA expression (Figure 2B, upper panel). However, bicalutamide was unable to prevent rapamycin-induced increase in AR expression (Figure 2B, 2nd panel), and had no effect on rapamycin inhibition of p70S6 kinase phosphorylation (Figure 2B, 3rd panel). These results indicate that bicalutamide prevented rapamycin-induced AR transcriptional activity without affecting rapamycin’s effect on downstream targets of mTOR.

Figure 2. Rapamycin-induced AR transcriptional activity reduces its growth inhibitory effect.

Figure 2

Open in a new tab

(A)LNCaP and C4-2 cells were left untransfected or were co-transfected with plasmids expressing hPSA-luc and β-gal and treated with 1 nM rapamycin and/or 10 μM bicalutamide for 48 hours prior to lysis followed by luciferase assay. Data represents mean luciferase luminescence ± S.D. (n=3) normalized to β-gal. (B) Effect of combination treatment with rapamycin and bicalutamide on activation and expression of various proteins. (upper panel) Rapamycin treatment stimulated PSA expression which was inhibited by bicalutamide, (2nd panel) whereas rapamycin induced AR expression was not affected by bicalutamide. (3rd panel) Rapamycin inhibited p70S6 kinase phosphorylation in the presence or absence of bicalutamide. Note that these drugs did not affect the expression of p85, represented by the upper band in the same panel. (Lowermost panel) Neither drug affected the expression of p70S6 kinase. (C,D) Short-term effect of rapamycin (1 nM) and bicalutamide (10 μM) on proliferation rates of (C) LNCaP and (D) C4-2 cells as measured by MTT assay. Cells were plated in 24-well plates and treated for 1–5 days, controls were treated with vehicle (DMSO) only. Data indicate mean ± standard deviation (S.D.) of three individual readings.

If rapamycin-induced AR activity increased transcription of target genes resulting in increased cell growth, then inhibition of this activity by bicalutamide treatment should prevent growth. To test this hypothesis, we treated LNCaP and C4-2 cells with 1 nM rapamycin, 10 μM bicalutamide or a combination of the two. Rapamycin inhibited cell growth significantly compared to vehicle in both LNCaP (54.86%, p=0.001) (Figure 2C) and C4-2 (45.37%, p<0.001) cells (Figure 2D). In contrast, bicalutamide inhibited cell growth in androgen-dependent LNCaP (48.64%, p=0.001) but not in androgen-independent C4-2 cells (−6.018%, p=0.198) (Figure 2C,D). Despite this, bicalutamide sensitized both cell lines to the effects of rapamycin (Figure 2C,D), (69.43% decrease in LNCaP cells, p=0.001; 63.13% in C4-2 cells, p<0.001). However, this effect was not seen in AR-null PC-3 cells (not shown), indicating that this effect needed the presence of the AR. Our results indicate that rapamycin-induced AR transcriptional activity induced proliferation and prevented complete growth inhibition by rapamycin, whereas bicalutamide reversed this effect by inhibiting rapamycin-induced AR transcriptional activity. Thus, rapamycin induction of AR transcriptional activity that results in increased cell growth is a likely cause for the resistance that prostate cancer cells develop to long-term rapamycin treatment.

Rapamycin and bicalutamide in combination induces apoptosis in prostate cancer cells

We further investigated the effect of the combination of rapamycin and bicalutamide in AI sublines of LNCaP cells. Since growth inhibition can be caused by decreased cell proliferation or by increased apoptosis, we investigated the effect of this combination of drugs on both factors. Following 2 days of treatment, rapamycin, but not bicalutamide, resulted in decreased S-phase in androgen-independent LNAI cells (31.33% with rapamycin, p=0.0028 vs 8.22% with bicalutamide, p=0.088) without significantly affecting G2/M phase or apoptosis as determined by flow cytometry (Figure 3A). The combination of bicalutamide and rapamycin caused further decrease in S-phase (39.5%, p=0.00099) (Figure 3A) and a substantial increase in the number of cells undergoing apoptosis (4.18-fold increase, p=0.029) (Figure 3A). Similar results were obtained with C4-2 cells (not shown). Thus, the combination of bicalutamide and rapamycin caused the onset of apoptosis, which explains the decreased growth by the combination treatment.

Figure 3. Bicalutamide and rapamycin in combination induce apoptosis in prostate cancer cells.

Figure 3

Open in a new tab

(A)Flow cytometric analysis of the effects of the two drugs on proliferation and apoptosis. LNAI cells were treated for 48 hours as indicated, ethanol-fixed, stained with propidium iodide and subjected to flow cytometry. The fraction of cells in the different phases of the cell cycle and those undergoing apoptosis was measured as described. Data represents mean ± S.D. (B) Clonogenic assay to determine the long-term effects of a combination of 1 nM rapamycin and 10 μM bicalutamide on the growth of LNAI cells. Data represents mean ± S.D. clonogenic potential after 14 days of treatment. Rapamycin alone caused a 43% reduction in growth rates whereas the combination of rapamycin and bicalutamide caused a reduction of 87.7% (p=0.00018). (C) Immunoblot demonstrating increased PARP cleavage by the combination of Rapamycin + bicalutamide, compared to the individual drugs, in both LNCaP and C4-2 cells. The box represents the mean PARP cleavage in C4-2 cells treated with the two drugs alone or in combination (n=3).

The long-term effect of rapamycin treatment was estimated by clonogenic assay. LNAI cells were cultured in the presence of vehicle (DMSO) or 1 nM rapamycin for 14 days. While bicalutamide as a single agent failed to inhibit growth in this cell line (21% increase, p=0.121), rapamycin as a single agent had a partial effect (42.69% reduction, p=0.0005) (Figure 3B). However, rapamycin and bicalutamide, in combination, resulted in almost complete inhibition of clone formation (87.72% reduction, p=0.00018) (Figure 3B). These results are consistent with the induction of apoptosis by the rapamycin-bicalutamide combination, as indicated by the onset of PARP cleavage in both LNCaP and C4-2 cells treated with the combination of the two drugs, whereas the individual treatments were significantly less effective (Figure 3C).

Apoptosis induced by the rapamycin-bicalutamide combination is mediated by the inhibition of both mTORC1 and mTORC2

Next, we investigated the mechanism by which the combination of rapamycin and bicalutamide induced large levels of apoptosis in androgen dependent as well as androgen-independent prostate cancer cells despite neither drug alone having a similar effect. The mTOR complexes mTORC1 (mTOR/raptor) and mTORC2 (mTOR/rictor) have, to the best of our knowledge, never been compared in prostate cancer. We investigated whether rapamycin induction of AR activity was mediated by the inhibition of these complexes. Rapamycin treatment did not significantly affect the expression of raptor (Figure 4A, upper panel), but severely impeded the activation of mTORC1 as indicated by the inability of the mTORC1 target p70S6 kinase to activate its substrate, the ribosomal protein S6 (Figure 4A, 2nd panel). This drug also decreased rictor expression at ≥ 1 nM (Figure 4A, 3rd panel), but not the expression of total Akt (Figure 4A, lowermost panel). Thus rapamycin inhibited both mTORC1 (mTOR/raptor) and mTORC2 (mTOR/rictor), albeit by two different mechanisms.

Figure 4. Rapamycin inhibition of both mTORC1 and mTORC2 induces apoptosis in prostate cancer cells.

Figure 4

Open in a new tab

(A)Effect of increasing doses of rapamycin on LNCaP and C4-2 cells treated for 48 hours. Raptor expression was not affected by rapamycin (upper panel), but its activation was impaired as indicated by the de-phosphorylation of the p70S6K substrate, the ribosomal protein S6 (rpS6) (2nd panel). On the other hand, rictor expression was severely impeded (3rd panel). (B) Effect of inhibition of mTORC1 and mTORC2 individually on apoptosis. C4-2 cells were transfected with a control siRNA or with raptor or rictor siRNA, and then treated with DMSO (vehicle) or 10 μM bicalutamide. Cells were collected after 48 hours and analyzed for percent of apoptotic cells by flow cytometry. (C) Effect of overexpression of raptor or rictor on apoptosis induced by rapamycin + bicalutamide. C4-2 cells were transfected with vector (pCMV) or with myc-raptor or myc-rictor, then treated with DMSO, 10 μM bicalutamide, 1 nM rapamycin or both. Apoptosis was analyzed as described above.

Since rapamycin inhibited both these complexes, the effect of the combination of rapamycin and bicalutamide on apoptosis could be mediated by mTORC1, mTORC2 or both. To determine the role of these complexes on apoptosis, we inhibited the expression of raptor or rictor using siRNA to both these proteins. Inhibition of both raptor and rictor induced apoptosis in C4-2 cells, although the inhibition of mTORC1 had a greater effect compared to the inhibition of mTORC2 (Figure 4B). Significantly, further treatment with bicalutamide enhanced the effect of raptor inhibition but not rictor inhibition. On the other hand, overexpression of both raptor and rictor inhibited apoptosis induced by the combination of rapamycin and bicalutamide (Figure 4C), but again, the effect of raptor overexpression was more significant than that of rictor overexpression. These results indicate that the effect of rapamycin on apoptosis is mediated by the inhibition of both mTORC1 and mTORC2.

Rapamycin-induced AR transcriptional activity is caused by inhibition of mTORC1, but not mTORC2

We next investigated the effect of these proteins on rapamycin-induced AR transcriptional activity. Since Akt is a regulator of survival in prostate cancer cells, we also investigated the effects of mTORC1 and mTORC2 on Akt phosphorylation. Depletion of raptor levels stimulated Akt phosphorylation (Figure 5A), whereas increased expression of raptor prevented rapamycin-induction of Akt phosphorylation in these cells (Figure 5B). Similarly, raptor siRNA stimulated AR transcriptional activity 74.4%, which is consistent with the effect of rapamycin (80.6% increase over control) (Figure 5C), whereas overexpression of raptor prevented rapamycin stimulation of AR transcriptional activity (Figure 5D). In contrast, rictor had the opposite effect – inhibition of rictor prevented rapamycin-induced Akt phosphorylation (Figure 6A) and AR transcriptional activity on hPSA-luc (Figure 6C), whereas overexpression of rictor stimulated Akt phosphorylation (Figure 6B) as well as AR transcriptional activity (Figure 6D). Thus mTORC1 inhibited while mTORC2 stimulated AR activity and Akt phosphorylation.

Figure 5. Rapamycin induced AR transcriptional activity is caused by inhibition of mTORC1.

Figure 5

Open in a new tab

(A) Effect of raptor on Akt phosphorylation. LNAI cells were treated with vehicle or 10 μM bicalutamide and 1 nM rapamycin for 48 hours in the presence of control or raptor siRNA. (B) Effect of the same doses of rapamycin and bicalutamide on Akt phosphorylation in the presence of an empty vector (pCMV) or a plasmid overexpressing raptor (myr-raptor) in LNAI cells. (C) Effect of a control siRNA or siRNAs against raptor or (D) a vector control or myr-raptor on AR transcriptional activity of LNCaP cells in the presence of vehicle or bicalutamide as determined by luciferase assay. Data shows hPSA-luc activity normalized to β-gal and represent mean ± S.D. fold change over vehicle control (n=3).

Figure 6. Rapamycin inhibition of mTORC2 inhibits Akt phosphorylation and AR transcriptional activity on hPSA-luc.

Figure 6

Open in a new tab

(A) Effect of rictor on Akt phosphorylation. LNAI cells were treated with vehicle or 10 μM bicalutamide and 1 nM rapamycin for 48 hours in the presence of control or rictor siRNA. (B) Effect of the same doses of rapamycin and bicalutamide on Akt phosphorylation in the presence of an empty vector (pCMV) or a plasmid overexpressing rictor (myr-rictor) in LNAI cells. (C) Effect of a control siRNA or siRNAs against rictor or (D) a vector control or myr-rictor on AR transcriptional activity of LNCaP cells in the presence of vehicle or bicalutamide as determined by luciferase assay. Data shows hPSA-luc activity normalized to β-gal and represent mean ± S.D. fold change over vehicle control (n=3).

Rapamycin’s effect on AR transcriptional activity is mediated by Akt phosphorylation

Next, we investigated the mechanism by which rapamycin induced AR transcriptional activity. Rapamycin-induced AR transcriptional activity on hPSA-luc was inhibited by Akt siRNA in C4-2 cells, whereas basal levels were minimally affected (Figure 7A). Further, transfection of a constitutively active form of Akt (pCMV-6-myr-Akt-HA), but not a control vector (pCMV-HA), promoted AR transcriptional activity both in vehicle- and rapamycin-treated cells (Figure 7B). Also, a dominant negative Akt mutant (pCMV-6-Akt-K179M) prevented this effect (Figure 7B). The plasmids were kindly provided by Dr. Thomas F. Franke, Columbia University, NY, and were described by us elsewhere (Ghosh et al., 2005). Akt has been shown to both stimulate and inhibit AR activity under different conditions (Lin et al., 2003); in this case, Akt has a stimulatory effect on the AR. These results demonstrate that the effects of rapamycin on AR transcriptional activity are mediated by Akt phosphorylation.

Figure 7. Rapamycin-induction of AR transcriptional activity is mediated by Akt.

Figure 7

Open in a new tab

(A) AR transcriptional activity in C4-2 cells transfected with control or Akt1 siRNA and treated with 1 nM rapamycin and 10 μM bicalutamide. Cells were co-transfected with hPSA-luc and β-gal and luciferase activity was estimated in the transfected cells after 48 hours of treatment. Data represents mean ± S.D. of three independent readings normalized to β-gal activity. Shown is the fold change over control (cells transfected with control siRNA and treated with vehicle only). (inset) PSA levels were estimated by Western blotting. Loading control was demonstrated by the levels of tubulin. (B) AR transcriptional activity in cells transfected with vector only or myr-Akt, together with hPSA-luc and β-gal, and treated with 1 nM rapamycin and 10 μM bicalutamide for 48 hours. In all cases, data represents mean ± S.D. (n=3) normalized to β-gal activity. Shown is the fold change over vector controls treated with vehicle only. (C) Transfection of constitutively active Akt (myr-Akt) inhibited rapamycin + bicalutamide induced apoptosis. C4-2 cells were transfected with vector control (pCMV) or myr-Akt, and treated with vehicle (DMSO), 1 nM rapamycin, 10 μM bicalutamide, or both, for 48 hours. % cells undergoing apoptosis was measured by flow cytometry.

Rapamycin’s effect on apoptosis is only partially mediated by Akt

However, constitutive expression of Akt only partially inhibited apoptosis induced by combination treatment with rapamycin and bicalutamide (Figure 7C), and is likely the effect of inhibition of mTORC2 but not mTORC1. Hence, Akt phosphorylation mediates the effects of rapamycin on AR transcriptional activity but only partially mediates the effect of rapamycin on apoptosis. These results indicate the presence of a strong Akt-independent cell survival pathway mediated by mTORC1. Thus mTORC1 and the AR activate parallel cell survival pathways. Therefore, simultaneous inhibition of both pathways by rapamycin and bicalutamide induce apoptosis in prostate cancer cells.

DISCUSSION

The goal of this paper was to determine the reason why prostate cancer cells developed resistance to rapamycin following long-term treatment with the drug and to design methods of overcoming this resistance. The effect of increasing AR transcriptional activity on cell proliferation is biphasic: whereas low levels stimulated proliferation, high levels inhibited it (see Supplementary data). Our data showed that treatment with 1 nM rapamycin induced a 2-fold increase in AR transcriptional activity, which was in the range that stimulated cell proliferation. This effect diminished the growth-inhibitory effects of rapamycin, resulting in resistance to rapamycin. Simultaneous treatment with rapamycin and bicalutamide, an inhibitor of AR transcriptional activity, sensitized the cells to rapamycin-induced growth inhibition and was able to overcome this resistance.

Our results indicate that the combination of rapamycin and bicalutamide, but not the individual drugs, induced significant apoptosis in prostate cancer cells. Rapamycin as monotherapy was unable to induce long-term growth inhibition due to the activation of an AR-dependent cell survival pathway. On the other hand, bicalutamide alone was unable to inhibit cell growth due to the presence of a strong Akt-independent survival pathway downstream of mTORC1. Thus mTOR kinase activity and AR transcriptional activity regulate survival in prostate cancer cells by parallel signaling pathways. When either pathway is inhibited, cell survival is regulated by the other one. Hence, apoptosis was induced only when both pathways were simultaneously inhibited, (schematically represented in Figure 8).

Figure 8. Scheme depicting the mechanism by which the combination of rapamycin and bicalutamide induced apoptosis in prostate cancer cells.

Figure 8

Open in a new tab

mTOR forms two complexes mTORC1 (with raptor) and mTORC2 (with rictor), both of which are inhibited by rapamycin in prostate cancer cells. Inhibition of mTORC2 inhibits AR transcriptional activity and cell survival in an Akt-dependent manner, as mTORC2 is a kinase for Akt phosphorylation. On the other hand, inhibition of mTORC1 induces apoptosis in an Akt- and AR-independent manner, but also stimulates Akt-phosphorylation and AR transcriptional activity. Stimulation of AR transcriptional activity and Akt phosphorylation by rapamycin treatment stimulated cell survival. Thus, the mTORC1 and mTORC2/Akt/AR pathways regulate cell survival in parallel in prostate cancer cells. This indicates that both pathways have to be simultaneously inhibited in order to induce apoptosis in these cells.

These data demonstrate that rapamycin inhibits both mTORC1 and mTORC2 in prostate cancer cells. Inhibition of mTORC1 induced apoptosis but also resulted in stimulation of AR transcriptional activity. mTORC1 phosphorylates downstream targets p70S6 kinase and 4E-BP1. Previous studies have shown that inhibition of p70S6 kinase stimulated Akt phosphorylation (Shi et al., 2005; Tzatsos & Kandror, 2006), whereas mTORC’s effects on cell survival are likely mediated by translation initiation. On the other hand, inhibition of mTORC2 inhibited both cell survival as well as AR transcriptional activity. The latter effects are likely mediated by Akt phosphorylation. Previous studies had shown that Akt is phosphorylated by mTORC2 at Ser 473 (Sarbassov et al., 2004; Sarbassov et al., 2006; Sarbassov et al., 2005b). However, Akt phosphorylation persisted even in cells treated with rictor siRNA (Figure 6A). This suggests that very little rictor is needed for Akt phosphorylation in prostate cancer cells. It is likely that AIPC cells have evolved to develop alternate pathways of Akt (Ser473) phosphorylation, as suggested by other studies (Persad et al., 2001).

The overall effect of rapamycin in these cells, therefore, is the stimulation of Akt phosphorylation. It may be noted that even in PTEN negative cells like LNCaP and its AI sublines, pAkt is not at saturation levels. PI3K is the enzyme catalyzing the conversion of PIP2 to PIP3, whereas PTEN is a phosphatase that converts PIP3 back to PIP2. PIP3 then phosphorylates PDK1 which in turn phosphorylates Akt at Thr 308. This stimulates phosphorylation at Ser 473. In the absence of PTEN, PI3K constitutively converts PIP2 to PIP3, which increases the basal level of Akt phosphorylation, but does not result in constitutive activation of Akt. Hence, even in PTEN negative cells, further stimulation with rapamycin results in additional phosphorylation of Akt.

We show that the effect of rapamycin on AR transcriptional activity is mediated by the increase in Akt phosphorylation. Notably, Akt has been shown to both stimulate and inhibit AR activity under different conditions (Lin et al., 2003); in this case, Akt has a stimulatory effect on the AR. Significantly, this data shows that rapamycin-induced AR transcriptional activity is ligand-dependent. Inhibition of ligand binding by bicalutamide prevented rapamyci’s effect on AR transcriptional activity.

In conclusion, in this study, we provide novel evidence that bicalutamide alone was unable to inhibit cell growth and induce apoptosis in AIPC cells, due to the presence of a strong androgen-independent, but rapamycin-sensitive, survival pathway downstream of mTOR. On the other hand, rapamycin as monotherapy was unable to induce long-term growth inhibition due to the stimulation of an AR-dependent cell survival pathway by rapamycin treatment. Rapamyci’s effects are mediated by the inhibition of both mTORC1 and mTORC2 – inhibition of mTORC1 stimulated AR transcriptional activity, but induced apoptosis in prostate cancer cells by an AR-independent mechanism; whereas rapamycin inhibition of mTORC2 inhibited AR transcriptional activity and also induced apoptosis by an AR-dependent mechanism. Thus the mTORC1 and AR pathways regulate survival in prostate cancer cells in parallel, and apoptosis was induced only when both pathways were simultaneously inhibited with rapamycin and the anti-androgen bicalutamide. These results explain why a combination of rapamycin and bicalutamide would be of therapeutic value in prostate cancer treatment.

MATERIALS AND METHODS

Cell Culture and Pharmacological Treatments

LNCaP cells were purchased from American Type Culture Collection, Manassas, VA, while C4-2 cells were from UroCor, (Oklahoma City, OK). Androgen-independent clones of LNCaP cells (LNAI cells) were obtained by prolonged culture of LNCaP cells in “androgen-free medium”: phenol-red free RPMI 1640 with 10% charcoal stripped FBS (CSS, Hyclone, Logan, UT). All other cells were cultured in “complete-medium”: RPMI 1640 medium with 10% fetal bovine serum (FBS, Invitrogen) unless otherwise specified. Bicalutamide (Casodex) was obtained from AstraZeneca, UK. Rapamycin was obtained from Calbiochem, EMD Biosciences, San Diego, CA.

Transfections and plasmids

Cells were transiently transfected using Lipofectamine 2000 reagent (Invitrogen) according to manufacturer’s specifications based on established protocols using 2μg plasmid DNA as described earlier (Ghosh et al., 1999; Ghosh et al., 2005). A human PSA reporter plasmid consisting of the human PSA 5′-flanking region (−631/−1) containing androgen response elements I and II (ARE I and ARE II) tagged to a luciferase construct (hPSA-luc) was kindly provided by Dr. Bandana Chatterjee, University of Texas Health Science Center at San Antonio, San Antonio, TX.

RNA inhibition

Cells were plated in 60 mm dishes and transfected with 50 pmoles of one of the following: AR siRNA, mTOR siRNA, Akt1 siRNA, raptor siRNA (Santa Cruz Biotechnlogy, Santa Cruz, CA) and rictor siRNA, consisting of a pool of 4 siRNA duplexes (Dharmacon Research Inc., Lafayette, CO). Sequences for the siRNA used are as follows: anti-mTOR siRNA: sense strand (A) CAGAGGCCCUAAAUAAGAA, (B) CAAGCGACAUCCCAUGAAA, (C) CUGAAACCAUGGUGAGAAA, anti-Raptor siRNA: sensestrand (A) CCAUGUAAUCAGAGCAUUA; (B) CAACCACAAUGAUGGUAUU; and (C) CCUAGAGGCUCAUUAUCUA, Anti-Akt siRNA: sense strand: UGCCCUUCUACAACCAGGA and anti-Androgen Receptor siRNA: sense strand (A) CAGUCCCACUUGUGUCAAA (B) CCUGAUCUGUGGAGAUGAA (C) GUCGUCUUCGGAAAUGUUA (D) GACAGUGUCACACAUUGAA. Anti-Rictor siRNA sense strands: (A) GACACAAGCACUUCGAUUAUU (B) GAAGAUUUAUUGAGUCCUAUU (C) GCGAGCUGAUGUAGAAUUAUU (D) GGGAAUACAACUCCAAAUAUU.

Flow cytometry

The fraction of cells in S-phase was determined by flow cytometry in propidium iodide (PI) stained ethanol-fixed cells as described previously (Ghosh et al., 2002), whereas the fraction of cells undergoing apoptosis was calculated as the percentage of cells appearing as a sub-G1 peak. Cells in early apoptosis were calculated as Annexin V stained cells following 15 minutes of dual staining by Annexin V-FITC and PI in unfixed cells. Flow cytometry was conducted on FACStar Plus (Becton Dickinson Immunocytometry Systems, San Jose, CA). Cells were illuminated with 200 mW of 488 nm light produced by an argon-ion laser. Fluorescence was read through a 630/22 nm band-pass filter (for propidium iodide) or a 530/30 nm band-pass filter (for Annexin V-FITC). Data was collected on 20,000 cells as determined by forward and right angle light scatter and stored as frequency histograms; data used for cell cycle analysis was further analyzed using MODFIT (Verity software, Topsham, ME).

MTT assay

Cells were plated in 24-well plates and treated as indicated. Following treatment, each well was incubated with 15 μl of 5 mg/ml 3-[4,5-Dimethylthiazol-2yl]-2,5-diphenyl-tetrazolium bromide (MTT) for 1 hour in a CO2 incubator at 37°C. The medium was aspirated and 0.5 ml DMSO was added per well. Formazan intensity was estimated at 560 nm.

Clonogenic Assay

Cell survival after treatment with rapamycin and/or bicalutamide alone or in combination was measured by clonogenic assay. Single cell suspensions of 6000 cells were seeded into 60-mm culturedishes on day 0 and allowed to attach for 24 h at 37°C in media containing 5% FBS. The cells were then treated with rapamycin (1nM), bicalutamide (10 μM) or a combination of the two. Control cells were treated with equivalent volume DMSO (vehicle for both drugs). Drugs were washed out 24 hours post-treatment and fresh 5% FBS media added. After 14 days, colonies were fixed in fixing solution (33.3% acetic acid and 66.7% methanol) for 15 min at RT and stained with 1.0% crystal violet. Dishes were washed with water and visible colonies containing approximately 50 or more cells were counted.

Western blotting and immunoprecipitation

These techniques were performed as described elsewhere (Ghosh et al., 2002; Ghosh et al., 2001). Mouse monoclonal anti-AR, Rabbit polyclonal anti-total Akt, anti-total p70S6K (recognizing phosphorylated and unphosphorylated forms of p70 and p85 S6 kinase), anti-mTOR and anti-tubulin were from Santa Cruz Biotechnology, Santa Cruz, CA. Rabbit polyclonal anti-phospho-Akt (Ser 473), anti-phospho-p70S6K(T389), ribosomal protein S6 and anti-phospho-S6, anti-rictor, anti-raptor were from Cell Signaling Technology, Beverly, MA. Mouse monoclonal anti-PSA antibody was from Neomarkers, Lab Vision Corporation, Fremont, CA. Unless otherwise stated, all data shown is representative of three different experiments showing similar results.

AR transcriptional activity

Reporter gene activity was determined by luciferase assay (Hartig et al., 2002). Cells were co-transfected with 2 μg of hPSA-luc with 2 μg of pCMV-βGal using Lipofectamine 2000 (Invitrogen, Grand Island, NY) according to the manufacturer’s recommendations. Cells grownin complete medium for 24 h were treated as required for an additional 48 h. After 48h, cells lysate were prepared for performing luciferase assays using a luciferase enzyme assay system (Promega Corp., Madison, WI). Each transfection experiment was performed in triplicate on at least three separate occasions. Results represent an average of independent experiments with data presented as relative luciferase activity using means ofuntreated controls as standards.

Supplementary Material

SUPPLEMENTARY MATERIAL

Acknowledgments

We would like to thank Dr. Hsing-Jien Kung for critical reading of the manuscript, Dr. Barry Furr, AstraZeneca, Cheshire, UK, for the gift of bicalutamide (Casodex), Dr. Bandana Chatterjee, University of Texas Health Science Center at San Antonio (UTHSCSA) for hPSA-luc construct; Dr. LuZhe Sun, UTHSCSA, for β-gal construct and LNAI cell line. We are grateful to Sherra Johnson for technical assistance in some of the experiments described. This work was supported by a Merit award from the Department of Veterans Affairs and award CA109057 from the National Cancer Institute.

References

  1. Agus DB, Cordon-Cardo C, Fox W, Drobnjak M, Koff A, Golde DW, Scher HI. Prostate cancer cell cycle regulators: response to androgen withdrawal and development of androgen independence. J Natl Cancer Inst. 1999;91:1869–76. doi: 10.1093/jnci/91.21.1869. [DOI] [PubMed] [Google Scholar]
  2. Boehmer A, Anastasiadis AG, Feyerabend S, Nagele U, Kuczyk M, Schilling D, Corvin S, Merseburger AS, Stenzl A. Docetaxel, estramustine and prednisone for hormone-refractory prostate cancer: a single-center experience. Anticancer Res. 2005;25:4481–6. [PubMed] [Google Scholar]
  3. Brown EJ, Albers MW, Shin TB, Ichikawa K, Keith CT, Lane WS, Schreiber SL. A mammalian protein targeted by G1-arresting rapamycin-receptor complex. Nature. 1994;369:756–8. doi: 10.1038/369756a0. [DOI] [PubMed] [Google Scholar]
  4. Cao C, Subhawong T, Albert JM, Kim KW, Geng L, Sekhar KR, Gi YJ, Lu B. Inhibition of mammalian target of rapamycin or apoptotic pathway induces autophagy and radiosensitizes PTEN null prostate cancer cells. Cancer Res. 2006;66:10040–7. doi: 10.1158/0008-5472.CAN-06-0802. [DOI] [PubMed] [Google Scholar]
  5. Cinar B, De Benedetti A, Freeman MR. Post-transcriptional regulation of the androgen receptor by Mammalian target of rapamycin. Cancer Res. 2005;65:2547–53. doi: 10.1158/0008-5472.CAN-04-3411. [DOI] [PubMed] [Google Scholar]
  6. Edwards J, Bartlett JM. The androgen receptor and signal-transduction pathways in hormone-refractory prostate cancer. Part 1: Modifications to the androgen receptor. BJU Int. 2005;95:1320–6. doi: 10.1111/j.1464-410X.2005.05526.x. [DOI] [PubMed] [Google Scholar]
  7. Gao N, Zhang Z, Jiang BH, Shi X. Role of PI3K/AKT/mTOR signaling in the cell cycle progression of human prostate cancer. Biochem Biophys Res Commun. 2003;310:1124–32. doi: 10.1016/j.bbrc.2003.09.132. [DOI] [PubMed] [Google Scholar]
  8. Ghosh PM, Bedolla R, Mikhailova M, Kreisberg JI. RhoA-dependent murine prostate cancer cell proliferation and apoptosis: role of protein kinase Czeta. Cancer Res. 2002;62:2630–6. [PubMed] [Google Scholar]
  9. Ghosh PM, Ghosh-Choudhury N, Moyer ML, Mott GE, Thomas CA, Foster BA, Greenberg NM, Kreisberg JI. Role of RhoA activation in the growth and morphology of a murine prostate tumor cell line. Oncogene. 1999;18:4120–30. doi: 10.1038/sj.onc.1202792. [DOI] [PubMed] [Google Scholar]
  10. Ghosh PM, Malik SN, Bedolla RG, Wang Y, Mikhailova M, Prihoda TJ, Troyer DA, Kreisberg JI. Signal transduction pathways in androgen-dependent and -independent prostate cancer cell proliferation. Endocr Relat Cancer. 2005;12:119–34. doi: 10.1677/erc.1.00835. [DOI] [PubMed] [Google Scholar]
  11. Ghosh PM, Mikhailova M, Bedolla R, Kreisberg JI. Arginine vasopressin stimulates mesangial cell proliferation by activating the epidermal growth factor receptor. Am J Physiol Renal Physiol. 2001;280:F972–9. doi: 10.1152/ajprenal.2001.280.6.F972. [DOI] [PubMed] [Google Scholar]
  12. Gingras AC, Raught B, Sonenberg N. Regulation of translation initiation by FRAP/mTOR. Genes Dev. 2001;15:807–26. doi: 10.1101/gad.887201. [DOI] [PubMed] [Google Scholar]
  13. Hartig PC, Bobseine KL, Britt BH, Cardon MC, Lambright CR, Wilson VS, Gray LE., Jr Development of two androgen receptor assays using adenoviral transduction of MMTV-luc reporter and/or hAR for endocrine screening. Toxicol Sci. 2002;66:82–90. doi: 10.1093/toxsci/66.1.82. [DOI] [PubMed] [Google Scholar]
  14. Hresko RC, Mueckler M. mTOR.RICTOR is the Ser473 kinase for Akt/protein kinase B in 3T3-L1 adipocytes. J Biol Chem. 2005;280:40406–16. doi: 10.1074/jbc.M508361200. [DOI] [PubMed] [Google Scholar]
  15. Jacinto E, Loewith R, Schmidt A, Lin S, Ruegg MA, Hall A, Hall MN. Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol. 2004;6:1122–8. doi: 10.1038/ncb1183. [DOI] [PubMed] [Google Scholar]
  16. Kremer CL, Klein RR, Mendelson J, Browne W, Samadzedeh LK, Vanpatten K, Highstrom L, Pestano GA, Nagle RB. Expression of mTOR signaling pathway markers in prostate cancer progression. Prostate. 2006;66:1203–12. doi: 10.1002/pros.20410. [DOI] [PubMed] [Google Scholar]
  17. Lee CH, Inoki K, Guan KL. mTOR Pathway as a Target in Tissue Hypertrophy. Annu Rev Pharmacol Toxicol. 2007;47:443–67. doi: 10.1146/annurev.pharmtox.47.120505.105359. [DOI] [PubMed] [Google Scholar]
  18. Lin HK, Hu YC, Yang L, Altuwaijri S, Chen YT, Kang HY, Chang C. Suppression versus induction of androgen receptor functions by the phosphatidylinositol 3-kinase/Akt pathway in prostate cancer LNCaP cells with different passage numbers. J Biol Chem. 2003;278:50902–7. doi: 10.1074/jbc.M300676200. [DOI] [PubMed] [Google Scholar]
  19. Lu S, Liu M, Epner DE, Tsai SY, Tsai MJ. Androgen regulation of the cyclin-dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Mol Endocrinol. 1999;13:376–84. doi: 10.1210/mend.13.3.0254. [DOI] [PubMed] [Google Scholar]
  20. Persad S, Attwell S, Gray V, Mawji N, Deng JT, Leung D, Yan J, Sanghera J, Walsh MP, Dedhar S. Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and amino acids arginine 211 and serine 343. J Biol Chem. 2001;276:27462–9. doi: 10.1074/jbc.M102940200. [DOI] [PubMed] [Google Scholar]
  21. Petrylak D. Therapeutic options in androgen-independent prostate cancer: building on docetaxel. BJU Int. 2005;96(Suppl 2):41–6. doi: 10.1111/j.1464-410X.2005.05946.x. [DOI] [PubMed] [Google Scholar]
  22. Sabatini DM, Erdjument-Bromage H, Lui M, Tempst P, Snyder SH. RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is homologous to yeast TORs. Cell. 1994;78:35–43. doi: 10.1016/0092-8674(94)90570-3. [DOI] [PubMed] [Google Scholar]
  23. Sarbassov DD, Ali SM, Kim DH, Guertin DA, Latek RR, Erdjument-Bromage H, Tempst P, Sabatini DM. Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol. 2004;14:1296–302. doi: 10.1016/j.cub.2004.06.054. [DOI] [PubMed] [Google Scholar]
  24. Sarbassov DD, Ali SM, Sabatini DM. Growing roles for the mTOR pathway. Curr Opin Cell Biol. 2005a;17:596–603. doi: 10.1016/j.ceb.2005.09.009. [DOI] [PubMed] [Google Scholar]
  25. Sarbassov DD, Ali SM, Sengupta S, Sheen JH, Hsu PP, Bagley AF, Markhard AL, Sabatini DM. Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB. Mol Cell. 2006;22:159–68. doi: 10.1016/j.molcel.2006.03.029. [DOI] [PubMed] [Google Scholar]
  26. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science. 2005b;307:1098–101. doi: 10.1126/science.1106148. [DOI] [PubMed] [Google Scholar]
  27. Sharef S, Jac J, Khan M, Amato R. Rapamycin for androgen-independent prostrate cancer (AIPC) Journal of Clinical Oncology, 2006 ASCO Annual Meeting Proceedings Part I. 2006;24(18S) (June 20 Supplement), 24. [Google Scholar]
  28. Shi Y, Yan H, Frost P, Gera J, Lichtenstein A. Mammalian target of rapamycin inhibitors activate the AKT kinase in multiple myeloma cells by up-regulating the insulin-like growth factor receptor/insulin receptor substrate-1/phosphatidylinositol 3-kinase cascade. Mol Cancer Ther. 2005;4:1533–40. doi: 10.1158/1535-7163.MCT-05-0068. [DOI] [PubMed] [Google Scholar]
  29. Tzatsos A, Kandror KV. Nutrients suppress phosphatidylinositol 3-kinase/Akt signaling via raptor-dependent mTOR-mediated insulin receptor substrate 1 phosphorylation. Mol Cell Biol. 2006;26:63–76. doi: 10.1128/MCB.26.1.63-76.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Wu L, Birle DC, Tannock IF. Effects of the mammalian target of rapamycin inhibitor CCI-779 used alone or with chemotherapy on human prostate cancer cells and xenografts. Cancer Res. 2005;65:2825–31. doi: 10.1158/0008-5472.CAN-04-3137. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SUPPLEMENTARY MATERIAL
NIHMS108335-supplement-SUPPLEMENTARY_MATERI.pdf (91KB, pdf)

RESOURCES