A differentiation pathway for B1 cells in adult bone marrow

Detailed Characterization of B1 Progenitors Suggests Heterogeneity in Lineage Commitment and/or Lineage Progression.

Lin⁻AA4.1⁺CD19⁺B220^Lo/− cells in bone marrow were originally described as progenitors with strong bias for producing B1 rather than conventional B2 lymphocytes (11). However, B1Ps are rare and flow cytometry did not reveal them to be a discrete population even when gating was stringently established with isotype-matched control antibodies. Therefore, we investigated additional parameters that would provide a background for further studies. Whereas B1Ps represent 0.1%–0.5% of nucleated marrow cells in BALB/c mice (11), they are consistently less frequent (0.05%–0.2%) in C57BL/6 mice (Fig. 1A). Consistent with the fact that B lymphopoiesis is largely driven by IL-7 (13), B1Ps were reduced threefold in IL-7Rα^−/− mice (Fig. 1). Bruton tyrosine kinase (Btk)-KO mice have a severe deficiency in peripheral B1 cells (14, 15), and it is interesting that B1P numbers were elevated in Btk^−/− marrow (Fig. 1). This is consistent with previous reports that responsiveness of lymphoid progenitors to IL-7 is abnormally high in related Xid^−/− mice (16). Lymphopoiesis does not progress beyond the Pro-B stage in recombination activating gene (RAG)-1^−/− or μ-MT mice (17, 18), and we found nearly normal numbers of B1Ps in their bone marrow.

Expression of RAG proteins and B-cell receptor (BCR) rearrangement represent important milestones in B lineage differentiation, and these parameters were used to gain additional information about the nature of B1Ps. RAG-1/GFP knock-in mice permit detection of RAG-1 locus activity, important for identifying RAG-1⁺ early lymphoid progenitors (ELPs) among the primitive lineage marker-negative, Sca-1⁺cKit^Hi (LSK) subset (19). Our results demonstrated that approximately 64% of Lin⁻Sca-1⁺cKit^LoIL-7Rα⁺ common lymphoid progenitors (CLPs) (20), 83% of CD19⁺B220⁺CD24⁺CD43⁺IgM⁻ Pro-B cells, and 84% of CD19⁺B220⁺CD43⁻IgM⁻ Pre-B cells (21) were RAG-1/GFP⁺ (Fig. 2A Top). Thus, it is informative that less than half of the B1P expressed RAG-1/GFP. As in previous studies, only 2% of IgM^HiCD11b⁺CD5^+/−B220^Lo/+ B1 cells in the peritoneal cavity (B1, PC) were positive for this reporter (22).

We constructed a new model by crossing RAG-1/Cre mice to animals with tandem-dimer red fluorescent protein (tdRFP) knocked into the ROSA26 locus (23, 24). Thus, cells with a lymphoid past are permanently marked, as was the case for 98% of B1 PC cells (Fig. 2A Middle). Nearly 60% of CLPs and 90% of Pro-B in bone marrow were RAG-1/tdRFP⁺, whereas approximately 56% of B1Ps were labeled. It is noteworthy that the intensity of tdRFP⁺ B1P was lower than that for mature B1 cells. As originally described for ROSA26 tdRFP mice (23), this tends to be the case for mitotically active cells.

An Ig and T cell receptor (TCR) gene recombination substrate system has been described that reports Ig/TCR rearrangement history by permanent expression of the VEX fluorochrome (25). In this model, CLP and Pro-B cells were shown to be approximately 30% and 90% VEX-positive, respectively. We have confirmed those findings and now show that 48% of B1Ps had recombined the reporter substrate (Fig. 2A Bottom). For comparison, approximately 89% of CD19⁺IgM^HiIgD^LoCD11b⁺ B1 PC were labeled.

Lymphoid progenitors in bone marrow are highly sensitive to sex steroids, and we have previously used this parameter to assess relatedness to other lineages (26–29). Therefore, we implanted time-release estrogen pellets into male mice and evaluated them 1 week later with respect to B1P (Fig. 2B). Whereas ELPs and CLPs were dramatically depleted, B1Ps were reduced by only 31% (range, 26%–37% in 10 total mice). Numbers of CD19⁺B220⁺CD24⁺CD43⁺IgM⁻ Pro-B and CD19⁺B220⁺CD43⁻IgM⁻ pre-B cells were reduced by 46% and 42%, respectively. Myeloid progenitors (Lin⁻Sca-1⁻cKit^Hi), spleen B cells, and B1 PC populations were unaffected. We found a similar modest decrease in B1P in pregnant mice (not shown), again indicating that only some are hormone-sensitive.

Most stem cells and ELPs spend considerable time in a quiescent, G₀ state whereas later stages of B lymphopoiesis involve actively dividing Pro-B cells (30). In terminal stages, B cells complete differentiation in the spleen without further expansion. Therefore, we used intracellular Ki67 staining to assess the mitotic activity of B1Ps. There was a higher proportion of Ki67-positive B1Ps (51%) than mature resting CD19⁺B220^HiIgM⁺ spleen B cells (11%), and likewise a considerably lower proportion than in Pro-B cells (80%; Fig. 2C). As an additional assessment of proliferative activity, we measured the incorporation of BrdU into the DNA of these populations in vivo over a 10-d period (Fig. 2D). B1Ps incorporated BrdU at a much slower rate than cycling Pro-B cells, but more rapidly than resting splenic B cells. Consistent with previous reports (31), more than 75% of Pro-B cells had incorporated BrdU by day 4. This contrasted with 35% and 8% labeling of B1P and splenic B cells, respectively. After 10 d of continual BrdU administration, nearly all Pro-B cells, but still only 63% of B1Ps and 21% of splenic B-cells, had incorporated BrdU.

In summary, most cells in the previously defined Lin⁻AA4.1⁺CD19⁺B220^Lo/− subset have characteristics associated with previously described lymphoid progenitors. Their requirement for IL-7Rα signaling, and negative regulation by Btk indicate that they have initiated development in the B lymphocyte pathway. However, their numbers are minimally affected by mutations related to Ig gene recombination or pre-BCR expression. Only 35% of B1Ps have an active RAG-1 locus, 56% have a history of RAG-1 expression, and 48% have evidence of Ig gene recombination. A subset was depleted by estrogen treatment, approximately one third were in active cell cycle, and approximately two thirds incorporated BrdU in a 10-d period. Although B1Ps are not homogeneous in any of these respects, these results may indicate a continuum of maturation and lymphoid lineage progression.

Adult Lymphoid Progenitors Are a Source of B1P.

The earliest hematopoietic origin of bone marrow B1Ps had not been previously investigated, and initial studies concluded that B1 cells may arise only during fetal life (6, 7). Therefore, we sorted a series of well characterized adult marrow progenitors and assessed their potential for generating B1Ps. These included hematopoietic stem cell-enriched LSK, RAG-1⁺/GFP⁺ ELPs, CLPs, Pro-B cells, and myeloid progenitors (MP). An additional AA4.1⁺CD19⁺CD24⁺CD21⁻IgM⁺ transitional-type 1 (T1) fraction of spleen B cells was included in some experiments as a negative control. We used a previously described trans-well culture system in which conditions were modified by addition of IL-7 and removal of IL-3 and IL-6 to improve viability of the earliest progenitors (11, 32, 33). Measurements were made after 7 or 12 d of culture. Unlike LSK, ELPs, and CLPs (Fig. 3A), myeloid-restricted progenitors and Pro-B and spleen T1 cells had no ability to make B1P cells in these conditions. Observation of serial cultures revealed that B1Ps were made more rapidly from CLPs than RAG-1⁺ ELPs, but ELPs eventually gave slightly higher yields [supporting information (SI) Fig. S1].

Some cells with the potential to make B1Ps might not have been detected under these artificial conditions. Therefore, the same progenitor populations were transferred to sublethally irradiated congenic Ly5.1 recipients before flow cytometry analysis of bone marrow. As in the trans-well culture system, LSKs, ELPs, and CLPs were sources of B1Ps (Fig. 3B). Of these, the highest yields were observed with CLPs and ELPs in temporal fashion 18 and 21 d after transplantation, respectively. Pro-B, myeloid progenitors, and spleen T1 cells never produced appreciable numbers of B1Ps during the 28-d reconstitution period (Fig. 3B, and not shown). Note that, in contrast to CLPs, LSK-derived B1Ps were not convincingly detected before day 28, yet they were consistently found in all 48 recipients in 3 experimental series. In a single experiment, yields of B1P were higher where LSK recipients were examined on day 35 (not shown).

These findings indicate how cells with the Lin⁻AA4.1⁺CD19⁺B220^Lo/− staining properties of B1P can be made from hematopoietic cells in adult bone marrow. We detected no evidence of affiliation with myeloid cells, and they were not made from relatively differentiated Pro-B or spleen T1 cells. Rather, they arose efficiently in vitro and in vivo from CLPs and then ELPs.

Lymphoid Progenitors in Adult Bone Marrow Can Generate B1 Lymphocytes.

As discussed earlier, it has been controversial whether all B1 cells arise from a fetal wave of lymphopoiesis or also can be made from adult progenitors (1, 6, 7, 34). To address this, adult marrow progenitors were sorted to high purity from C57BL/6 (CD45.2⁺) mice and transplanted into sublethally irradiated Ly5.1 (CD45.1⁺) congenic mice. Four weeks later, we analyzed the peritoneal cavity of recipient mice by flow cytometry to determine the relative yields of B1 and conventional B2 cells (Fig. 4A Top and 4B). Here, CD19⁺ B1 and B2 cells were discriminated as IgM^HiIgD^Lo and IgM^LoIgD^Hi, respectively. As may be expected, essentially no B1 cells were produced when myeloid progenitors or Pro-B or T1 cells were transplanted (not shown). Consistent with their original description (11), B1Ps were highly B1-biased (Fig. 4A Top Right). In contrast, more balanced B1-to-B2 ratios were observed with PC cells recovered from mice transplanted with ELPs or CLPs. When we analyzed donor B1 subsets, we found that CD19⁺IgM^HiCD11b⁺CD5⁺ B1a cells were slightly more numerous than their CD5⁻ B1b cohorts when B1Ps were transplanted (Fig. 4A Lower). This ratio was similar to that observed for peritoneal B1 subsets in normal mice (35, 36). It is perhaps noteworthy that the B1 cells generated from B1Ps were slightly more homogeneous with respect to CD5 densities than those generated from ELPs or CLPs (Fig. 4A Lower). In more limited experiments, we transplanted fetal liver lymphoid progenitors and found them to be more efficient in producing B1 cells than adult progenitors (not shown).

Consistent with published results (11), B1Ps were poor sources of either CD23^HiCD21^Lo follicular or CD23^LoCD21^Hi marginal-zone B2 lymphocytes resident in the spleen (Fig. 4C). In fact, B1Ps primarily generated CD23^LoCD21^Lo B cells, a fraction containing immature, transitional, and B1 lymphocytes. In contrast, conventional lymphoid progenitors produced the whole spectrum of splenic B cells. Utilization of V_H11 Ig genes is a property unique to B1 lymphocytes (37–39), and we found that donor-type CD45.2⁺CD19⁺ cells recovered from the PC of CLP recipients included lymphocytes with V_H11 sequences (see Materials and Methods and Fig. S2A). Importantly, V_H11 sequences were not detected in CD45.1⁺CD19⁺B220⁺CD43⁻IgM⁺ host B2 cells simultaneously harvested from the spleen.

Finally, 2-step transplantation experiments were conducted to explore precursor-product relationships between primitive lymphoid progenitors and B1P and B1 cells. CD45.2⁺ CLPs or ELPs were transferred into sublethally irradiated Ly5.1 (CD45.1⁺) recipients. Donor-derived B1Ps were isolated from marrow of the CLP or ELP transplanted mice 18 and 21 d later, respectively, before secondary transplantation into Ly5.1 hosts. Four weeks later, PC and spleen cells were recovered to assess B1 potential (Fig. 4D and not shown). We found that ELP- and CLP-derived B1Ps exhibited B1 bias similar to freshly isolated B1Ps, and preferentially generated IgM^HiIgD^Lo B1 cells (compare to Fig. 4A Top Right). Recipient spleens also contained few CD23⁺ B2 cells (not shown). Furthermore, we detected B1 cell distinctive V_H11 sequences in donor-derived CD19⁺ cells recovered from spleens and PC of these mice (see Materials and Methods and Fig. S2B).

Thus, previously characterized lymphoid progenitors in adult bone marrow can produce B1 cells when transplanted to sublethally irradiated adult recipients. Unlike B1Ps, ELPs and CLPs have the additional potential to generate substantial numbers of B2 cells. A complete differentiation sequence was indicated by the successful transfer of ELPs or CLPs, recovery of newly formed B1Ps from bone marrow, and generation of B1 cells in secondary recipients. We conclude that B1Ps represent an intermediate stage between primitive lymphoid progenitors and B1 cells.

Mice.

C57BL/6 (CD45.2 alloantigen; Jackson Laboratory), B6-SJL/Ly5.1 (CD45.1 alloantigen; Jackson Laboratory), and B6-RAG-1/GFP knock-in mice were bred and maintained in the Laboratory Animal Resource Center at the Oklahoma Medical Research Foundation (Oklahoma City, OK). RAG-1^−/−, IL7Rα^−/−, and μ-MT mice were purchased from the Jackson Laboratory. VEX and Btk^−/− mice have been described previously (25, 46). A new model was created by crossing RAG-1/Cre mice to animals with tdRFP knocked into the ROSA26 locus (23, 24). These animals will be described in more detail elsewhere. All mice were 8 to 14 weeks old, and male and female mice were used with equal probability, save in the estrogen experiments (as described later).

Isolation of Cell Populations and Flow Cytometry.

Cell manipulations were performed in Hanks' balanced salt solution with 5% FCS. Marrow cells were isolated from the long bones of donor mice, and erythrocytes were lysed by briefly re-suspending in NH₄Cl⁻ hypotonic solution. PC cells were acquired by lavage with 10 mL Hanks' balanced salt solution plus 5% FCS. To isolate progenitor populations for culture and transplantation, BM cells were enriched by negative selection by labeling marrow with Ly6G+C/Gr-1 (RB6–8C5), CD11b/Mac-1 (M1/70), TER-119, CD3 (17A2), CD8 (53–6.7), CD19 (1D3), and B220 (14.8), and then immuno-magnetically depleted with the BioMag goat anti–rat IgG system (Qiagen). All cells were treated with Fc-receptor block (2.4G2) before fluorescent staining and sorting. After staining marrow with biotin-anti-lineage markers (Gr-1, CD11b, CD19, CD45R/B220, Ter119, CD3ε, CD8α, and NK1.1), APC-anti–cKit (2B8) and PE-Cy5-anti-Sca-1 (D7; eBioscience), PE-anti-IL-7Rα (A7R34; eBioscience), and secondary streptavidin PE-Texas Red (Caltag Laboratories), Lin⁻ populations were sorted using either a MoFlo (Dako Cytomation) or FACSAria cytometer (BD Biosciences) into specific populations. LSK cells were obtained as Lin⁻ckit^HiScaI⁺RAG-1/GFP⁻, whereas ELPs were sorted as Lin⁻ckit^HiSca-1⁺RAG-1/GFP⁺. CLPs were sorted as Lin⁻ckit^LoSca-1⁺IL-7Rα⁺. Myeloid progenitors were sorted as Lin⁻Sca-1⁻ckit^Hi, and Pro-B cells were sorted as CD19⁺B220⁺CD24⁺CD43⁺IgM⁻. Anti-CD19 and CD45R/B220 Abs were excluded from lineage depletions when isolating B1 Progenitors (11). Whole spleen samples were immuno-magnetically depleted for T cells (CD3, CD8) and myeloid cells (Gr-1, CD11b) before isolation of AA4.1⁺CD19⁺CD24⁺CD21⁻IgM⁺ T1 cells. Dead cells were excluded by propidium iodide staining (Molecular Probes). Purification of each subset was achieved by double sorting, and confirmed by post-sort analysis. Cells harvested from killed recipient mice were analyzed to determine the phenotypes of resident or donor cells. Abs included biotinylated CD3 (145–2C11), CD8 (53–6.7), CD11b (M170), TER-119, Gr-1 (RB6–8C5), IgM (R6–60.2), and NK1.1 (PK136); CD5 (53–7.3) APC, IgD (11–26c.2a) PE, CD23 (2G8) APC (Southern Biotech), CD21 (7G6) PE, IgM (R6–60.2) PerCpCy5.5, CD19 (1D3) APC-Cy7, CD93 (AA4.1) APC, B220 (RA3–6B2) PE-Cy5, and CD45.2 (104) FITC. Flow cytometry was performed on a BD LSRII (BD Biosciences), and FlowJo software (Treestar) was used for data analysis. All Abs came from BD PharMingen unless otherwise stated.

Intravenous Progenitor Transfers.

Recipient mice were given 650 Rads of radiation from a ¹³⁷Cs source (Mark I γ-irradiator; J.L. Shepard and Associates). Mice were anesthetized with isoflurane (Isosol; Vedco), and sorted populations were infused intravenously by retro-orbital injection. Host mice were 8- to 12-week-old B6-SJL/Ly5.1 (CD45.1 alloantigen); donor cells were from 8- to 14-week-old C57BL/6 or B6-RAG-1/GFP mice expressing the CD45.2 alloantigen. PC, spleen, and BM cells from one femur were collected separately from recipient mice, and CD45.2⁺ donor-derived cells were assayed by flow cytometry, as described earlier.

Estrogen Treatment In Vivo.

Time-release pellets of 17β-estradiol, 0.1 mg/pellet, 21-d release (Innovative Research of America) were implanted s.c. into 8- to 12-week-old male C57BL/6 mice with a 10-gauge precision trocar. After 1 week, mice were killed and PC, spleen, and BM cells were analyzed by flow cytometry.

Cell Cycle Kinetics Analysis.

Single-cell suspensions of C57BL/6 marrow and spleen were fixed and permeabilized using the BD Cytofix/Cytoperm kit (BD Biosciences), and stained intracellularly with FITC anti-Ki-67 (B56) or MOPC-21 isotype control. Mice were given an i.p. injection of 100 μg/100 μL BrdU in PBS solution (BD Biosciences), with continual administration of BrdU-enriched drinking water (0.8 mg/mL; Sigma-Aldrich) thereafter for the duration of the experiment. At defined time points, marrow from a single femur was collected from 4 mice and analyzed by intracellular staining with FITC anti-BrdU (FITC BrdU flow kit; BD Biosciences).

Trans-well Cultures.

Sorted progenitors were cultured in a trans-well system previously described (11) for 7 to 12 days, with OP9 stromal cells provided by J.C. Zúñiga-Pflücker (Toronto, ON, Canada) plated to sub-confluence in the upper chamber. The RPMI 1640 contained 10% FCS, 20 ng/mL Flt3-L, 20 ng/mL stem cell factor, 10 ng/mL IL-7, 10 ng/mL recombinant human thymic stromal lymphopoietin, 1 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells were fed by replacing half the volume with fresh media and cytokines every 4 days.

Ig Gene Repertoire Analysis.

For all samples, cells were resuspended in TRIzol Reagent (Invitrogen). RNA was extracted using standard protocol. RT-PCR was performed using OneStep RT-PCR Kit (Qiagen). For positive and negative controls, forward primers included MH3, MH4, MH5, MH6, MH7, MH11, MH12–1, and MH12–2. DS-MurCmu-Int was used as reverse primer. The PCR product was cloned into TA vector from TOPO cloning kit (Invitrogen).

White colonies were picked for mini-prep extraction and sequencing. For samples, forward primers were M-VH2, M-VH3, M-VH4, M-VH5, M-VH6, M-VH8, M-VH10, M-VH13, M-VH11(B), M-VH12(B)-1, and M-VH12(B)-2. JH-1 and JH-2 were used as reverse primers. PCR primers were digested with restriction enzyme Age1 and SalI (New England Biolabs). The digestion product was cloned into AB vector. Colonies were subsequently chosen for sequencing.

Primer Sequences: MH3, CAGGTTACTCTGAAAGWG; MH4, GAGGTCCARCTGCAACAR; MH5, CAGGTCCAACTVCAGCAR; MH6, GAGGTGAASSTGGTGGAA; MH7, GATGTGAACTTGGAAGTG; MH11, GAAGTGCAGCTGTTGGAG; MH12–1, CAGATGCAGCTTCAGGAG; MH12–2, CAGATTCAGCTTAAGGAG; DS-MurCmu-Int, AGG AGA CGA GGG GGA AGA C; M-VH2, CTGCAACCGGTGTACATTCA CAGGTCCAACTGCAGCAG; M-VH3, CTGCAACCGGTGTACATTCACAGGTCCAGCTGCAGCAA; M-VH4, CTGCAACCGGTGTACATTCA GAGGTCCAGCTGCAACAA; M-VH5, CTGCAACCGGTGTACATTCA GAGGTCCAGCTGCAACAG; M-VH6, CTGCAACCGGTGTACATTCA CAGGTGCAGCTGAAGCAG; M-VH8, CTGCAACCGGTGTACATTCAGAAGTGAAGCTGGTGGAG; M-VH10, CTGCAACCGGTGTACATTCACATGTCCAACTGCAGCAG; M-VH13, CTGCAACCGGTGTACATTCACAGATCCAGTTGGTGCAG; M-VH11(B), CTGCAACCGGTGTACATTCAGAAGTGCAGCTGTTGGAG; M-VH12(B)-1, CTGCAACCGGTGTACATTCA CAGATGCAGCTTCAGGAG; M-VH12(B)-2, CTGCAACCGGTGTACATTCA CAGATTCAGCTTAAGGAG; JH-1, TGCGAAGTCGACGCTGAGGAAACGGTGACCGTG; JH-2, TGCGAAGTCGACGCTGAGGAGACTGTGAGAGTG.

Statistics.

Prism V3.02 software (GraphPad) was used for statistical analysis. Intergroup comparisons were performed with the unpaired Student t test. P values were 2-tailed and considered significant if less than 0.05.