Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Mar 1.
Published in final edited form as: Cell Microbiol. 2008 Nov 27;11(3):461–474. doi: 10.1111/j.1462-5822.2008.01267.x

Genetic analysis of Drosophila melanogaster susceptibility to intestinal Vibrio cholerae infection

Cristin D Berkey 1, Nathan Blow 1,†, Paula I Watnick 1,2,*
PMCID: PMC2666625  NIHMSID: NIHMS82744  PMID: 19046341

Summary

We previously demonstrated that Vibrio cholerae is able to colonize the intestine of the fly to produce a lethal infection. Here we present the results of a genetic screen undertaken to identify factors that alter susceptibility of the fly to intestinal V. cholerae infection. In this model of infection, the Eiger/Wengen signalling pathway protects the fly against infection. Furthermore, mutations within the IMD signalling pathway increase resistance to intestinal V. cholerae infection and increase programmed cell death within the intestinal epithelium during infection. We propose that programmed cell death protects the intestinal epithelium against V. cholerae infection and therefore that the fly may serve as a useful model in which to study modulation of intestinal epithelial cell survival by commensal and pathogenic intestinal bacteria as well as the pathological processes leading to erosion of the intestinal epithelium and intestinal malignancy.

Introduction

Drosophila melanogaster, the common fruit fly, has been intensively and effectively employed as a model organism in many scientific disciplines (Baker and Thummel, 2007; Leopold and Perrimon, 2007; Nehme et al., 2007; Song and Tanouye, 2008). Recently, the fly has been used as a model in the field of immunology, elucidating aspects of the interaction between pathogens and the innate immune system. These studies inform not only the pathogenesis of human disease, but also the life cycle of pathogens borne by insect vectors.

Much has been learned about the innate immune response of the fly to both non-pathogenic and pathogenic bacteria. Until recently, most studies have employed the septic injury model in which bacteria are introduced into the haemolymph by penetration of the cuticle (Leulier et al., 2000; Mansfield et al., 2003; Erickson et al., 2004; Park et al., 2005; Schneider et al., 2007). In septic injury, humoral immunity is activated by two signalling pathways that are named Toll and IMD for critical proteins in these pathways (Ferrandon et al., 2007). The Toll pathway responds primarily to Gram-positive bacteria and fungi and ultimately results in nuclear translocation of the NF-κB homologue, Dif, which activates the transcription of a subset of the antimicrobial peptides encoded within the Drosophila genome. The IMD pathway responds primarily to Gram-negative pathogens. Components of the IMD signalling pathway are depicted in Fig. 1A. PGRP-LC and PGRP-LE are cell-associated receptors that sense DAP-type peptidoglycans of Gram-negative bacteria (Gottar et al., 2002; Takehana et al., 2004; Kaneko et al., 2006; Aggrawal and Silverman, 2007). Signalling then proceeds through IMD, a death domain-containing adaptor protein (Lemaitre et al., 1995; Georgel et al., 2001), resulting in phosphorylation and cleavage of the NF-κB homologue Relish as follows. First, IMD is thought to initiate assembly of a complex containing the IKKβ homologue IRD5 and the IKKγ homologue Kenny, encoded by the key gene (Rutschmann et al., 2000a; Lu et al., 2001). Activation of this complex by Tak1, a MAPKKK, leads to Relish phosphorylation (Rutschmann et al., 2000a; Stoven et al., 2000; Vidal et al., 2001). FADD, another death domain-containing protein, is thought to associate with IMD, leading to activation of Dredd, a caspase-8 homologue that cleaves Relish (Chen et al., 1998; Hu and Yang, 2000; Stoven et al., 2003). Once Relish is cleaved, the N-terminal product translocates to the nucleus where it binds DNA and modulates gene transcription (Hedengren et al., 1999). Signalling through the IMD pathway activates transcription of a subset of genes encoding antimicrobial peptides that differs from that activated by the Toll pathway.

Fig. 1. The IMD pathway increases susceptibility to V. cholerae infection.

Fig. 1

Open in a new tab

A. Schematic diagram of a subset of the components of the IMD pathway.

B–E. Fractional survival of faddEY10870, faddEY14017, dreddB118, key1 or relEY08061/relEY08061 and relEY08061/TM6, Sb flies is compared with w1118 flies (control). Log-rank test analysis demonstrated a statistically significant difference between survival of control flies and faddEY10870 mutants (P < 0.0001), faddEY14017 mutants (P < 0.0001), dreddB118 mutants (P = 0.0029), key1 (P < 0.0001) mutants and relEY08061 homozygotes (P < 0.0001). The difference between survival of control flies and relEY08061 heterozygotes was not significant (P = 0.0810).

Drosophila possess one TNF homologue, which has been named Eiger, and one TNF receptor homologue, which has been named Wengen (Igaki et al., 2002; Kanda et al., 2002; Kauppila et al., 2003). Indirect evidence suggests that the Drosophila Eiger/Wengen pathway may play a role in the innate immune response. Components of the Eiger/Wengen pathway are shown in Fig. 8A. The Drosophila genome encodes two TNF receptor-associated factors, Traf1 and Traf2. Association of Wengen with Traf1 activates a signal transduction pathway leading to apoptosis, while association of Wengen with Traf2 leads to activation of IMD signalling and antimicrobial peptide expression (Cha et al., 2003). Because Eiger mutants are more susceptible than control flies to extracellular but not intracellular pathogens within the haemolymph, it has been suggested that the Eiger/Wengen pathway modulates the activity of phagocytes, which are responsible for the cell-mediated defence against extracellular pathogens (Schneider et al., 2007).

Fig. 8. Flies harbouring mutations in the TNF pathway demonstrate increased susceptibility to V. cholerae infection.

Fig. 8

Open in a new tab

A. Components of the Drosophila TNF pathway.

B. Fractional survival of traf1c00231, traf1c03104, traf2e02066 and traf2f00233 mutant flies is compared with that of w1118 (control) flies. Log-rank test analysis demonstrated a statistically significant difference between survival of w1118 flies and traf1c00231 mutants (P < 0.0001) or traf1c03104 mutants (P < 0.0001), but not traf2e02066 mutants (P = 0.0711) or traf2f00233 mutants (P = 0.4248).

C. Fractional survival of traf1c03104 mutant flies is compared with the corresponding transposon excision strain (traf1 excised) and w1118 (control) flies. A statistically significant difference was seen between survival of the w1118 flies and traf1c03104 mutant flies (P < 0.0001) and between survival of the excision strain and traf1c03104 mutant flies. However the difference in survival between w1118 flies and the excision strain was not statistically significant (P = 0.5150).

D. Fractional survival of egr1 and egr3 mutants is compared with that of the parental strain. A statistically significant difference was seen between the parental strain and both egr1 (P < 0.0001) and egr3 (P < 0.0001) mutant flies.

E. Fractional survival of traf1c00231 flies inoculated with V. cholerae by septic injury was compared with that of w1118 flies (control). Log-rank test analysis demonstrated no statistically significant difference between survival of control flies and traf1c00231 mutants.

Less is known about epithelial immunity within the Drosophila intestine. Production of reactive oxygen species (ROS) by dual oxidase appears to be the first line of defence against susceptible microbes (Ha et al., 2005). Antimicrobial peptides produced as the result of signalling through the IMD pathway are the second line of defence (Ryu et al., 2006). A cellular immune response within the gut lumen has not been observed to date. However, invasive bacteria that successfully transit the intestinal epithelium are phagocytosed. Lastly, if invading intestinal bacteria escape phagocytosis, systemic humoral immunity is activated (Nehme et al., 2007).

Vibrio cholerae, a Gram-negative halophilic bacterium, is the causative agent of the deadly, secretory diarrhoeal disease cholera (Faruque et al., 1998). Cholera is contracted by ingestion of contaminated food or water. We have recently developed D. melanogaster as an animal model in which to study the interaction of the intestinal pathogen V. cholerae with the host intestine (Blow et al., 2005). Following ingestion of V. cholerae, Drosophila also develop a lethal infection. Secretion of cholera toxin is responsible for the massive diarrhoea that causes lethal disease in humans. Cholera toxin enters intestinal epithelial cells, potentiates adenylate cyclase and induces an outward Cl− current through activation of cyclic AMP-responsive chloride channels (Moriarty and Turnberg, 1986). We previously found that ingestion of wild-type V. cholerae kills flies more rapidly than ingestion of a cholera toxin mutant (Blow et al., 2005). However, even when a cholera toxin mutant is ingested, the flies die prematurely. Therefore, we hypothesize that other bacterial factors participate in lethal infection.

Because only a small number of humans exposed to V. cholerae actually develop disease, the innate immune response and genetic profile of the host is thought to play an important role in the course of infection. However, an in-depth exploration of the genetic basis of host susceptibility to cholera has been impeded by the absence of a genetically tractable, immune-competent model host. We sought to use D. melanogaster as a model to identify host factors that alter the host–pathogen interaction. To this end, we carried out a large-scale screen to identify Drosophila insertion mutants with altered susceptibility to V. cholerae infection. The results of this screen suggested to us that programmed cell death (PCD) protects the fly against lethal intestinal V. cholerae infection. Furthermore, mutations in the IMD pathway increased resistance to infection whereas mutations in the Eiger/Wengen pathway increased susceptibility. Here, we provide evidence that V. cholerae disrupts the Drosophila intestinal epithelium. We propose that programmed death of intestinal cells protects the intestinal epithelium against V. cholerae assault, and we provide evidence that mutations in the IMD pathway increase programmed intestinal cell death, leading to increased resistance to infection.

In mammals, NF-κB activates cellular survival through a signalling pathway homologous to the IMD pathway (Hacker and Karin, 2006). This work suggests that the NF-κB homologue Relish may have a parallel function. Furthermore, the importance of PCD in interactions of mammalian epithelia with both commensal and pathogenic bacterial has been established (Barnich and Darfeuille-Michaud, 2007; Mimuro et al., 2007). Our results suggest that the fly can be used as a model in which to study these types of host–microbe interactions as well as the diseases resulting from them.

Results

A forward genetic screen identifies Drosophila mutants with altered susceptibility to V. cholerae infection

We previously demonstrated that ingestion of V. cholerae by D. melanogaster causes a lethal, cholera toxin-dependent infection (Blow et al., 2005). Furthermore, we identified a limited number of Drosophila mutants with altered susceptibility to V. cholerae. To identify additional novel host susceptibility factors, we performed a forward genetic screen of Drosophila transposon-insertion mutants. Approximately 6200 randomly selected transposon-insertion strains (4200 P-element and 2000 piggyBac) were obtained from the Bloomington Stock Center and screened for susceptibility to V. cholerae as described in Experimental procedures. In the primary screen, 346 strains with altered susceptibility to V. cholerae were identified. Approximately 60 strains contained insertions in or near genes encoding proteins with high homology to a conserved domain or a mammalian protein of known function. These were re-screened in triplicate in at least three independent experiments. Sixteen Drosophila mutants consistently displayed statistically significant phenotypes (Fig. S1, Table S1). The proteins encoded by the relevant mutant genes can be grouped into the categories of innate immunity, Ca2+ binding, PCD and unknown function (Table 1).

Table 1.

Proteins identified in screen and confirmed in subsequent tests.

Gene product Mutant phenotype Homology
Innate immunity
 Relish Resistant NF-κB
 Cyp6a20 Resistant Cytochrome p450
 Insc Resistant Cell division/differentiation
 Traf1 Sensitive TNF-adaptor protein
Calcium binding
 NucB1 Resistant Calcium-binding protein
 CBP Sensitive Calcium-binding protein
Programmed cell death
 Wwox Sensitive Tumour suppressor
 Cathepsin D Sensitive Aspartyl protease
 SamDC Sensitive S-adenosylmethionine decarboxylase
Unknown
 CG13890 Resistant Enoyl-CoA hydratase/carnithine racemase
 CG14722 Resistant WD40-containing protein
 CG14411 Resistant Phospholipid phosphatase-related
 Vap-33-1 Resistant Vesicle trafficking
 Taspase 1 Sensitive Threonine aspartase
 Fermitin 1 Sensitive Band 4.1/pleckstrin domains
 CG7843 Resistant Arsenite resistance protein
Open in a new tab

Proteins with previously characterized roles in innate immunity included Relish, the NF-κB homologue in the IMD signalling pathway (Hedengren et al., 1999); Traf1, an adaptor protein that links signalling through Wengen to PCD (Cha et al., 2003); and Inscuteable and Cyp6a20, both of which increased susceptibility to V. cholerae infection. A previous microarray analysis of Drosophila haemocytes demonstrated that exposure to Escherichia coli increases transcription of the genes encoding these two proteins by greater than twofold (Johansson et al., 2005). Inscuteable has no domains of known function but plays a role in asymmetric cell division leading to cellular differentiation (Kraut and Campos-Ortega, 1996; Kraut et al., 1996). Cyp6a20 is a cytochrome 450 mono-oxygenase, which may play a role in detoxification of noxious substances such as pesticides (Daborn et al., 2007). The role of these proteins in immunity to infection has not been characterized.

We identified two gene products with multiple EF hand domains, which are known to bind Ca2+. The first, Nucleobindin 1, is a homologue of the mammalian Calnuc (Otte et al., 1999). Calnuc possesses two EF hand domains and a DNA-binding leucine zipper domain that is believed to play a role in the induction of autoimmunity to nucleic acids. The Drosophila homologue, NucB1, has three EF hand domains but does not possess the leucine zipper domain. Both the mammalian and Drosophila proteins localize to the Golgi apparatus and are believed to represent a store of Ca2+ that is released into the cytoplasm to take part in Ca2+-mediated signalling events (Lin et al., 1998; Kawano et al., 2000). The other protein, CBP, is annotated as a sarcoplasmic calcium-binding protein and contains three EF hand motifs. The function of this protein is unknown.

Our screen uncovered a number of factors whose mammalian homologues are involved in PCD. The mammalian WW domain-containing oxidoreductase, Wwox, has been identified as a tumour suppressor and activator of apoptosis (Chang et al., 2005; Iliopoulos et al., 2006). It is located at a fragile site within the human genome and protein expression is reduced or absent in many tumours (Finnis et al., 2005). In our tests, the Drosophila wwox mutant displayed increased susceptibility to infection. The lysosomal protease Cathepsin D is a well-established mediator of PCD (Minarowska et al., 2007). The cathD mutant was exquisitely sensitive to infection. S-adenosylmethionine decarboxylase or SamDC is a key enzyme in the polyamine biosynthesis pathway (Williams-Ashman et al., 1972; Pegg, 1984). While polyamines fulfil many functions in the cell, they are known to be activators of apoptosis within the mammalian intestinal epithelium (Seiler and Raul, 2005). As with other PCD mutants, the samDC mutant was found to be sensitive to infection.

As indicated in Table 1, our screen identified a number of transposon insertions within the transcripts of genes encoding proteins that have not been thoroughly studied in Drosophila but whose mammalian homologues play a role in activation of PCD. This led us to the hypothesis that PCD protects the fly against intestinal infection.

IMD pathway signalling increases susceptibility to intestinal V. cholerae infection

In previous studies that examined Gram-negative bacterial infections of the Drosophila intestine, IMD pathway mutants were found to succumb to infection more rapidly than control flies. Therefore, we were surprised to find that the Relish mutant identified in our screen was resistant to infection. Relish is contained within a large intron of the Nmdmc gene, encoding an NAD-dependent methyl-enetetrahydrofolate dehydrogenase, and transcription of Relish is initiated at four sites yielding four Relish transcripts termed RA, RB, RC and RD (Hedengren et al., 1999). Only RC, which is 3.1 kb in length, is induced during infection. The Relish mutant identified in our screen (relEY08061) contains an insertion 41 bp upstream of the RB transcription start site and within the 5′ non-coding region of the RA transcript. Interestingly, the more commonly studied relE20 and relE38 mutants, both of which contain a deletion encompassing the start sites of all four Relish transcripts, displayed increased susceptibility to V. cholerae infection (data not shown). However, unlike the relEY08061 mutant, the mortality of relE20 and relE38 mutants was also increased on standard fly medium and sterile LB broth. Increased mortality in the absence of infection has previously been noted for these mutants (Hedengren et al., 1999).

To determine whether the susceptibility phenotype of the relEY08061 mutant was due to genetic background, we out-crossed relEY08061/relEY08061 mutants to doubly balanced TM3, Sb1/TM6B, Tb1Drmio flies and tested the susceptibility of the F2 progeny to V. cholerae infection. Because only a small number of doubly balanced flies were obtained from this cross, we did not test the susceptibility of this class. As shown in Fig. 1B, we observed a resistant phenotype for relEY08061/relEY08061 flies. In contrast, the susceptibility of rel heterozygotes (relEY08061/TM3, Sb1) was not significantly different from that of control flies. These results indicate that the observed resistance phenotype is recessive and linked to the relEY08061 allele.

To confirm the role of the IMD pathway in infection, we obtained three fadd mutants, one key mutant (encoding Kenny) and one dredd mutant, and assayed the susceptibility of each of these mutants to V. cholerae infection. Similarly to the relEY08061 mutant, we found that each of these mutants was also resistant to V. cholerae infection (Fig. 1B–E and Fig. S2). To confirm that the mutant allele was responsible for the decreased susceptibility of faddEY10870 and dreddB118 mutant flies, we also tested the susceptibility of faddEY10870/Df(3R)93Fx2 and dreddB118/Df(1)su(s)R194 transheterozygotes. These flies were also resistant to infection (Figs S3 and S4). The susceptibility of faddEY10870/fadd and dreddB118/dredd flies to V. cholerae infection is similar to that of control flies, demonstrating that these alleles are recessive (data not shown). These data provide strong evidence that the IMD signalling pathway mediates susceptibility to intestinal V. cholerae infection.

Signalling through the IMD pathway does not increase bacterial load

Because our previous experiments suggested that V. cholerae remains localized to the gastrointestinal tract 24 h after ingestion by D. melanogaster (Blow et al., 2005), we questioned whether signalling through the IMD pathway might increase susceptibility to infection by increasing the bacterial load within the intestine. To test this, we performed colony counts on control flies and IMD mutant flies. As shown in Fig. 2, the bacterial burden of faddEY10870, dreddB118 and relEY08061 mutants, which were resistant to infection, was comparable to or greater than that of control w1118 flies. This suggests that the resistance of IMD pathway mutants to V. cholerae infection is not the result of decreased intestinal colonization.

Fig. 2.

Fig. 2

Open in a new tab

V. cholerae bacterial load in IMD pathway mutants. Colony counts were assayed 24 h after infection. For each assay, 10 flies were homogenized in LB broth, and dilutions of the resulting suspension were plated. w1118 (WT), faddEY10870 (fadd), dreddB118 (dredd) and relEY08061 (rel) flies were used. Each experiment was performed in triplicate and repeated on three separate days, producing nine data points for each genotype. There was a significant increase in the bacterial burden of dredd and relish mutants flies as compared with w1118 flies (P < 0.0001 and P = 0.0010 respectively). The difference in bacterial burden between fadd mutants and w1118 flies was not significant (P = 0.2376).

Signalling through the IMD pathway does not potentiate the action of cholera toxin

The action of cholera toxin is the primary cause of death in patients with cholera. In a previous publication, we demonstrated that cholera toxin also hastens death of V. cholerae-infected flies. We hypothesized that if the IMD pathway functioned only to potentiate the action of cholera toxin, then the susceptibility of control and IMD pathway mutant flies to infection with a V. cholerae ΔctxB mutant should be comparable. To test this, we compared survival of control and IMD pathway mutant flies infected with a V. cholerae ΔctxB mutant. As compared with control flies, key1 and relEY08061 mutant flies were more resistant to infection with a ΔctxB mutant (Fig. 3). A similar result was observed for relEY08061 flies infected with a V. cholerae ΔctxA mutant (data not shown). This suggests that signalling through the IMD pathway does not increase susceptibility to V. cholerae infection solely by potentiating the action of cholera toxin.

Fig. 3. IMD pathway signalling does not increase susceptibility solely by potentiating the action of cholera toxin.

Fig. 3

Open in a new tab

A. Fractional survival of w1118 (WT Dm) infected with wild-type V. cholerae (WT Vc) or a ΔctxB mutant (ctxB) and key1 (key) mutant flies infected with a ΔctxB mutant (ctxB). Log-rank test analysis demonstrated a statistically significant difference in survival of w1118 flies and key1 flies infected with infected with a V. cholerae ΔctxB mutant (P < 0.011).

B. Fractional survival of w1118 (WT Dm) infected with wild-type V. cholerae (WT Vc) or a ΔctxB mutant (ctxB) and relEY08061 (rel) mutant flies infected with a ΔctxB mutant (ctxB). Log-rank test analysis demonstrated a statistically significant difference in survival of w1118 flies and relEY08061 flies infected with infected with a V. cholerae ΔctxB mutant (P < 0.0001).

Ingestion of V. cholerae disrupts the Drosophila intestinal epithelium

Our previous experiments demonstrated that V. cholerae remains localized to the gastrointestinal tract of control flies in the early stages of infection (Blow et al., 2005). However, the results presented here suggest that susceptibility to V. cholerae infection is not dependent solely on pathogen abundance in the intestine or the action of cholera toxin. Therefore, we questioned whether V. cholerae might be interacting with the gastrointestinal tract in a more invasive way. To evaluate this, we removed intestines from uninfected and infected wild-type flies, prepared thin sections, and then evaluated these by electron microscopy. As shown in Fig. 4, the intestines of uninfected flies demonstrated a healthy, well-aligned brush border. In contrast, the intestines of approximately half of the infected flies revealed microvilli in various stages of disintegration as well as cytoplasmic vacuoles consistent with autophagy. In typical infections of control flies with wild-type V. cholerae, the first flies expire during the second day of infection, and all flies are dead by the third day. Therefore, on the first day of infection, variations in the extent of intestinal damage are expected. We conclude that V. cholerae infection damages the intestinal epithelium.

Fig. 4.

Fig. 4

Open in a new tab

Transmission electron microscopy of Drosophila midguts. Electron micrographs of midguts dissected from w1118 flies fed LB (uninfected) or LB containing V. cholerae (infected) for 24 h. Midguts of flies fed LB demonstrated long organized microvilli whereas flies fed V. cholerae often showed disorganized and shortened microvilli and an increase in intracellular vacuoles (arrows).

Ingestion of V. cholerae activates antimicrobial peptide transcription through IMD pathway signalling

Because the intestinal epithelium is damaged during V. cholerae infection, we hypothesized that the humoral immune response might be activated. To test this, we isolated mRNA from whole flies and performed Northern blots to detect transcription of dipt, which is regulated by the IMD pathway and encodes the antimicrobial peptide Diptericin. As shown in Fig. 5, a significant increase in dipt transcription was observed upon V. cholerae infection of control flies. As expected, dipt transcription was not detectable in infected faddEY10870 and dreddB118 mutants. Dipt transcription was detected in relEY08061 mutant flies, suggesting that the transposon insertion does not affect induction of the RC transcript during infection. These results demonstrate that (i) intestinal V. cholerae infection activates antimicrobial peptide transcription through IMD pathway signalling, and (ii) Diptericin does not play a dominant role in resistance to intestinal V. cholerae infection. Because induction of dipt transcription is marked, we hypothesize that this represents activation of the systemic humoral immune response consistent with invasive and possibly disseminated infection.

Fig. 5.

Fig. 5

Open in a new tab

Transcription of dipt is activated during infection with V. cholerae. Assessment of dipt transcript levels in uninfected and infected w1118 (control), and infected relEY08061 (relish), dreddB118 (dredd) and faddEY10870 (fadd) mutant flies by Northern analysis. rp49 transcript is shown as a control.

IMD pathway signalling does not mediate susceptibility to systemic V. cholerae infection

Because of the possibility of disseminated disease, we questioned whether the phenotype of IMD pathway mutants might reflect increased resistance to V. cholerae located within the haemolymph. To test this, wild-type, dreddB118 and key1 mutant flies were infected with V. cholerae by septic injury. As shown in Fig. 6, dredd mutants were slightly more sensitive to systemic infection, while susceptibility of key mutants was not significantly different from that of control flies. Similar susceptibility phenotypes were observed for flies infected with inocula up to 100 times more dilute (data not shown). Therefore, the increased susceptibility of the dredd mutant to systemic V. cholerae infection is observed over a range of inoculum sizes. These findings, which are consistent with previous studies (Park et al., 2005), suggest that resistance of IMD pathway mutants to V. cholerae infection is not the result of modulation of the systemic immune response.

Fig. 6.

Fig. 6

Open in a new tab

IMD mutant flies are not more resistant to V. cholerae infection in a septic injury model: fractional survival of dreddB118 and key1 flies inoculated with V. cholerae by septic injury was compared with that of w1118 flies (control). Log-rank test analysis demonstrated a statistically significant difference between survival of control flies and dreddB118 mutants (P = 0.0002), but not between control flies and key1 mutants (P = 0.1199). Flies pricked with a needle dipped in LB did not die.

IMD signalling represses PCD within the Drosophila intestine

Programmed cell death is a common mechanism by which eukaryotic cells defend themselves against intra-cellular pathogens (Vergne et al., 2006; Deretic, 2008; Orvedahl and Levine, 2008; Yano and Kurata, 2008). Based on our finding that V. cholerae damages the intestinal epithelium and on the results of our genetic screen, which suggested that PCD protects the fly against V. cholerae infection, we hypothesized that PCD within the intestinal epithelium itself might protect the fly against invasion by V. cholerae. Because IMD signalling affected neither intestinal colonization nor susceptibility to systemic infection, we hypothesized that signalling through this pathway might decrease PCD within the intestinal epithelium, thus increasing susceptibility to V. cholerae infection. To test this, we compared TUNEL staining of the intestines of control and dreddB118 mutant flies. In this experiment, intestines were removed 24 h after exposure to V. cholerae. As shown in Fig. 7, TUNEL staining was reproducibly observed throughout the intestines of dreddB118 mutant flies, whereas little staining was observed in the intestines of control flies. TUNEL staining of the intestines of uninfected dredd mutants was similar to that of control flies, suggesting that PCD is not increased in the intestines of dredd mutants at baseline (data not shown). Our results suggest that, in the presence of V. cholerae infection, the IMD pathway either directly or indirectly suppresses programmed death of intestinal epithelial cells.

Fig. 7.

Fig. 7

Open in a new tab

Increased programmed cell death is observed in the intestines of IMD mutant flies: TUNEL staining of the intestines of V. cholerae-infected w1118 (control) and dreddB118 mutant flies. Micrographs of the intestines of three flies are shown.

The Eiger/Wengen signalling pathway mediates resistance to V. cholerae infection

The Eiger/Wengen signalling pathway (Fig. 8A) has previously been implicated in resistance to extracellular pathogens within the Drosophila haemolymph (Schneider et al., 2007). As shown in Fig. 8B, the traf1c03104 mutant identified in our screen demonstrated increased susceptibility to V. cholerae infection. Two additional traf1 insertion mutants (traf1c00231 and traf1EP578) also demonstrated increased susceptibility to infection (Fig. 8B and Fig. S5). To confirm that the transposon insertion was responsible for the increased susceptibility of the traf1c03104 mutant flies, precise excision of the piggyBac transposon was performed, and the susceptibility to V. cholerae of the resulting traf1/traf1 flies was assayed. As shown in Fig. 8C, transposon excision resulted in susceptibility that was similar to that of control flies.

To determine if both branches of the Eiger/Wengen signalling cascade were involved in resistance to V. cholerae infection, we also tested the susceptibility to V. cholerae infection of two traf2 insertion mutants; however, the susceptibility of these mutants was similar to that of control flies (Fig. 8B).

Eiger is the Drosophila TNF homologue that is upstream of Traf1 in the Eiger/Wengen signalling cascade. For this reason, we tested two eiger mutants, egr1 and egr3, both of which possess small deletions that remove the first coding exon of the gene (Igaki et al., 2002). Similarly to traf1 mutants, the egr variants had increased susceptibility to V. cholerae infection (Fig. 8D). These results suggest that the Eiger/Wengen pathway plays a role in resistance to V. cholerae infection.

Because previous studies have suggested that the Eiger/Wengen pathway mediates susceptibility to systemic infection (Schneider et al., 2007), we also tested the susceptibility of traf1 mutants in the septic injury model of infection. As shown in Fig. 8E, no difference in susceptibility was observed between traf1 mutants and control flies. This suggests that, as was found for IMD pathway mutants, the susceptibility of traf1 mutant flies is not the result of a modulation of the systemic immune response. Signalling through Traf1 has previously been associated with activation of PCD (Cha et al., 2003). Therefore, we hypothesize that the increased susceptibility of traf1 mutants is the result of decreased PCD within the intestine. However, because PCD within the intestines of control flies and traf1 mutant infected with V. cholerae was below the level of detection of our TUNEL assay, we were unable to evaluate this hypothesis (data not shown).

Discussion

In this work, we present evidence that ingestion of V. cholerae disrupts the brush border of the Drosophila intestinal epithelium and eventually leads to death. Furthermore, a genetic analysis of host susceptibility to this infection suggests that PCD and the Eiger/Wengen signalling pathway extend survival, whereas the IMD signalling pathway hastens death. While this is counter to previously documented roles for the IMD signalling pathway, we present evidence supporting a model in which the IMD signalling pathway accelerates infection by suppressing PCD.

When V. cholerae was fed to D. melanogaster, we observed an invasive infection leading to disruption of the brush border. This has also been seen in intestinal Pseudomonas entomophila infection of the fly (Vodovar et al., 2005; Liehl et al., 2006). In contrast, while Serratia marcescens is able to transit the Drosophila intestinal epithelium after ingestion, it does not appear to dramatically disrupt the brush border (Nehme et al., 2007). The presence or absence of brush border disintegration may reflect differences in pathogenesis. For instance, disintegration of the brush border may be the result of an overly exuberant and destructive innate immune response, while entry of a pathogen into intestinal epithelial cells by stealth may represent a specialized virulence programme. Alternatively, these differences in infectious sequelae may reflect differences in pathogen presentation to the host. For example, V. cholerae, S. marcescens and P. entomophila infection models differed in that the bacteria were ingested from LB broth, 50 mM sucrose or crushed bananas respectively. The differences in host epithelial cell integrity may reflect differences in virulence gene transcription in each of these media or simply the extent to which these media can support bacterial growth.

The gastrointestinal tract is continually bombarded with microbes that accompany ingested nutrients. Some microbes do not survive their passage through the gastrointestinal tract, some pass through intact, some colonize the intestine providing and receiving symbiotic functions, and some cause morbidity and mortality of the organism through pathogenic mechanisms. Studies of microbes that do not normally result in death of the fly have indicated that the antimicrobial action of ROS produced within the gut by dual oxidase allows the fly to coexist with these non-pathogenic microbes (Ha et al., 2005). When ROS are not produced or are not effective, antimicrobial peptides may serve this protective antimicrobial function. In the absence of these two antimicrobial substances, non-pathogenic microbes grow to high titres within the fly and result in death (Ryu et al., 2006). Our genetic analysis suggests that PCD also protects the fly against invasive intestinal infection. One possibility is that PCD preserves the integrity of the intestinal epithelium. In support of this, disruption of the intestinal epithelium by mutation of the gene encoding myosin IB leads to increased levels of PCD, which removes damaged cells from the epithelium (Hegan et al., 2007). Another possibility is that PCD destroys cells that have been penetrated by V. cholerae. Forms of PCD and, in particular, auto-phagic cell death are common mechanisms by which cells self-destruct in order to destroy invaders (Birmingham and Brumell, 2006; Birmingham et al., 2006; Py et al., 2007; Deretic, 2008; Orvedahl and Levine, 2008; Suzuki and Nunez, 2008; Yano and Kurata, 2008). In V. cholerae infection of the fly, future areas of investigation must include characterization of the type of PCD at work in this infection and definitive establishment of a causal relationship between PCD and resistance to infection.

Rather than providing immunity, the IMD pathway mediates susceptibility to V. cholerae infection. In mammals, components of the TNF signalling pathway are homologous to that of the IMD signalling pathway. However, the output of these pathways has been considered to be divergent, with the mammalian pathway resulting in activation of cellular survival and the Drosophila pathway resulting in antimicrobial gene transcription (Tanji and Ip, 2005). Here we provide the first evidence suggesting that, in the intestine, IMD pathway signalling suppresses PCD. However, we have not yet excluded the possibility that increased cell death observed in IMD pathway mutants may be the indirect result of an alteration in the intestinal environment.

These studies have focused on a genetic analysis of host susceptibility to V. cholerae infection. However, it is likely that the bacterium also plays a role in this process. First of all, the susceptibility of control flies to V. cholerae infection suggests that local antimicrobial substances such as ROS and antimicrobial peptides do not control infection. This may be either due to resistance of V. cholerae to these substances or due to an ability of the bacterium to block their production. Second, very little cell death is observed in the intestines of control Drosophila infected with V. cholerae. In contrast, PCD is abundant in the intestines of infected IMD pathway mutants. This raises the question of whether there are bacterial factors that suppress PCD in control flies and factors that stimulate PCD in the absence of signalling through the IMD pathway. Future studies will be focused on the identification of such bacterial factors.

Dysregulation of cell death within the gastrointestinal epithelium is associated with many pathological conditions. Inflammatory bowel disease is characterized by a decrease in intestinal apoptosis leading to lesions within the intestinal epithelium, bacterial overgrowth and pathological inflammation (Sipos et al., 2005; Edelblum et al., 2006). Furthermore, pathogens of the gastrointestinal tract, such as Helicobacter pylori, are known to suppress epithelial cell death in order to enhance colonization of the epithelium (Mimuro et al., 2007). Lastly, suppression of PCD predisposes to malignancy, while activators of PCD are effective therapies for it (Watson, 2004; van der Woude et al., 2004). We propose that this model of intestinal infection may be used to understand and modulate host interactions with pathogenic and commensal bacteria that lead to intestinal inflammation and malignancy.

Experimental procedures

Bacterial strains, fly strains and growth media

Bacterial strains were propagated in Luria–Bertani (LB) broth supplemented with streptomycin (100 μg ml−1). MO10, a V. cholerae O139 clinical isolate, and mutants derived from this strain were used in all experiments (Waldor and Mekalanos, 1994). The V. cholerae ΔctxB mutant has previously been described (Blow et al., 2005). A w1118 strain obtained from the Bloomington Stock Center was used to generate flies used as controls in all experiments (Thibault et al., 2004). dreddB118 mutants (Leulier et al., 2000) were obtained from the labs of Dr Won Jae Lee (Ewha Woman’s University, Seoul, Korea) and Dr Norbert Perrimon (Harvard Medical School). egr1 and egr3 mutants as well as the parental strain carrying the egrGS9830 insertion (Igaki et al., 2002) were gifts of Dr David Schneider (Stanford University, CA). The key1 mutant (Rutschmann et al., 2000b) was a gift of Dr Neil Silverman (University of Massachusetts Medical Center, MA). The Df(1)R194 deficiency strain was a gift of Dr Nicholas Baker (Albert Einstein College of Medicine, NY). All other mutants were obtained from the Bloomington Stock Center or the Harvard Exelixis Collection. All strains used in the secondary screens described here are listed in Table S2. Drosophila strains were reared at 24°C on standard Drosophila media.

V. cholerae mutant construction

The V. cholerae ΔctxA mutant, harbouring a 539 bp deletion in the ctxA gene (VC1457), was constructed as previously described (Haugo and Watnick, 2002). Briefly, the following PCR primers were used to amplify segments of the V. cholerae genome bordering a 539 bp segment of the ctxA gene: A1 (5′-GCAATCGCATGAGGCGTTTTATTA-3′), A2 (5′-TTACGAGC GGCCGCAGGTGTAAAATTCCTTGA-3′), A3 (5′-TGCGGCCG CTCGTAAGTACTCACTCTGTCCTCTTGGCATA-3′) and A4 (5′-CCTTTGCAGCGCAAGCGCTGTG-3′). These two segments were ligated using the gene splicing by overlap extension (SOE) technique (Horton et al., 1990; Lefebvre et al., 1995) and cloned into a suicide plasmid. The segment of homologous DNA containing the ctxA deletion was inserted into the chromosome of V. cholerae by double homologous recombination.

Large-scale genetic screen for Drosophila mutants with altered susceptibility to V. cholerae

Fly stocks containing piggyBac and P-element insertions were obtained from the Bloomington Stock Center and tested as follows. The wild-type V. cholerae O139 strain (MO10) was cultured overnight at 27°C in LB broth supplemented with streptomycin. This culture was diluted into fresh LB broth in a 1:10 ratio, and 1 ml of this dilution was dispensed into a 0.75-cm-high cellulose plug placed at the bottom of a fly vial. Ten male and 10 female flies were removed from each mutant stock and dispensed into separate vials inoculated with V. cholerae. Flies and bacteria were incubated at 24°C, and the number of surviving flies was recorded daily until all flies were dead. Cohorts of mutant flies with similar genetic backgrounds were tested simultaneously. The average time to death and standard deviation at each time point were calculated for the cohort. Strains for which survival of males and females fell outside one standard deviation, with respect to the cohort, at three consecutive time points were selected for further study. While the trends in susceptibility were similar for male and female flies of similar genetic backgrounds, female flies survived approximately 24 h longer than their male counterparts. Therefore, only male flies were used in subsequent experiments.

Generation of deficiency transheterozygotes

faddEY10870/faddEY10870 and dreddB118/dreddB118 mutant flies were mated with Df(3R)93Fx2/TM6C, Sb1 and Tb1Df(1)su(s)R194/Fm7fez-lacZ flies, respectively, to yield faddEY10870/Df(3R)93Fx2 or dreddB118/Tb1Df(1)su(s)R19 progeny, which were used in susceptibility assays.

Transposon excision

The wild-type traf1 allele was regenerated from the traf1c03104 allele by precise excision of the piggyBac transposon as follows. traf1c03104/traf1c03104 flies were mated with CyO, P{FRT(w+)Hsp70-PBac\T}2/wgSp-1 flies, whose genome contains the transposase under control of the Hsp70 heat shock promoter. After 3 days, adults were removed, and the resulting oocytes of the genotype CyO, P{FRT(w+)Hsp70-PBac\T}2/traf1c03104 were heat shocked for 1 h at 37°C for 7 days to activate expression of the transposase. Male and virgin female CyO, P{FRT(w+)Hsp70-PBac\T}2/Traf1 flies generated by this treatment, in which the transposon excision could be identified by a white eye phenotype, were collected and mated to each other to generate flies which were homozygous for an uninterrupted traf1 gene.

Drosophila survival assays

For intestinal infection, survival was assayed as previously described (Blow et al., 2005). Briefly, 30 male flies were divided evenly between three vials either containing a cellulose acetate plug saturated with 2 ml of LB broth supplemented with streptomycin alone or containing a 1:10 dilution of an overnight culture of V. cholerae that had reached early stationary phase. Viable flies were counted at least once in 24 h. For septic injury, 20 flies were pricked in the dorsal thorax with a 29-gauge needle dipped in a solution containing early stationary-phase bacteria diluted to an OD600 of 0.05 in fresh LB media. Flies were maintained in vials containing a cellulose acetate plug saturated with 5% sucrose in phosphate-buffered saline (PBS). Flies were inoculated in the evening, and the numbers of viable flies were recorded hourly during the following day. Survival curves were constructed for both intestinal and systemic infections, and log-rank tests were used to determine statistical significance. Reproducibility of all survival data was confirmed in at least three independent experiments.

Quantification of V. cholerae within flies

To determine the numbers of V. cholerae within control and mutant fly lines, 10 male flies were placed in a vial containing a cellulose acetate plug inoculated with a 1:10 dilution of an overnight culture of V. cholerae in LB broth containing streptomycin. After 24 h, flies were anaesthetized with CO2, pooled in an eppendorf tube and homogenized with a pestle in 200 μl of LB broth containing streptomycin. Large particles of debris were allowed to settle briefly, and the bacterial suspension was removed. Dilutions of this suspension were plated on LB agar containing streptomycin (100 μg ml−1). Colony-forming units (cfu) per fly were enumerated. Each experiment included three replicates, and the assay was repeated three times. Rinsing of flies in dilute bleach and processing of the intestine alone did not significantly alter total bacterial counts, suggesting that the contribution of external contamination to cfu per fly is small (data not shown). Furthermore, no colonies were cultured from flies fed LB broth alone, suggesting that all bacteria retrieved on LB agar plates supplemented with streptomycin were V. cholerae.

RNA isolation and Northern analysis

Total RNA was extracted from 100 flies using the Drosophila total RNA extraction protocol from the Center for Genomics and Bioinformatics (Bloomington, IN). Briefly, pools of 50 flies were anaesthetized with CO2 and immediately frozen in liquid nitrogen. They were then homogenized in 1 ml of Trizol reagent (Invitrogen) using a plastic pestle, and RNA was extracted using the standard Trizol protocol. The extracted RNA was re-suspended in water to yield a final volume of 100 μl. Two pools of 50 flies were then combined and subjected to RNeasy purification using the standard RNeasy mini kit (Qiagen) protocol. The optional DNase treatment was included.

Northern analysis was performed using the NorthernMax kit (Ambion). RNA (7 μg) was mixed with 3 vols of formaldehyde load dye and separated by electrophoresis on a 1% agarose morpholinepropanesulfonic acid (MOPS) gel containing formaldehyde. RNA was then transferred to a Brightstar Plus membrane (Ambion). Probes for dipt and rp49 were amplified using the following primers: (i) diptF: GGCTTATCCGATGCCCGACG, (ii) diptR: TCTGTAGGTGTAGGTGCTTCC, (iii) rp49F: CCGCT TCAAGGGACAGTATC and (iv) rp49R: ATGGTGCTGCTATC CCAATC. These probes were labelled using the BrightStar Psoralen-Biotin non-isotopic labelling kit (Ambion) and detected using the Brightstar Biodetect non-isotopic chemiluminescent detection system (Ambion). Levels of dipt were evaluated relative to levels of the rp49 ribosomal protein transcript, which remain constant during infection.

Transmission electron microscopy

Fly midguts were dissected into Grace’s insect medium and transferred immediately to FGP fixative (1.25% formaldehyde, 2.5% glutaraldehyde, 0.03% picric acid, 0.05–0.16 M sodium cacodylate buffer, 0.03% calcium chloride) for 2 h at room temperature. Midguts were then washed overnight at 4°C in sodium cacodylate buffer. Samples were embedded, and ultra-thin sections were prepared for examination on a Tecnai G2 Spirit BioTWIN electron microscope.

TUNEL staining

Flies were allowed to ingest V. cholerae for 24 h as described above and anaesthetized using CO2. Intestines were rapidly dissected into 100 μl of Grace’s Insect medium. Dissected intestines were maintained on ice prior to fixation. TUNEL staining was carried out using the In Situ Cell Death Detection Kit (Roche Applied Science). Intestines were fixed in 4% paraformaldehyde/1×PBS for 1 h and then washed three times in PBS. To permeabilize cells, intestines were incubated for 1 h at 37°C in 10 mM Tris-HCl buffer, pH 7.5 containing proteinase K (10 μg ml−1) and then washed three times with PBS. All subsequent steps were carried out according to the manufacturer’s protocol. The stained intestines were observed with an Eclipse TE-2000-E microscope (Nikon) equipped with fluorescein isothiocyanate and DAPI optical filters and an Orca digital CCD camera (Hamamatsu). A computer equipped with IP Laboratory (BD Biosciences) was used for image acquisition and processing.

Supplementary Material

Table S2

Table S2. Drosophila strains used in this study.

supplementary. Supporting information.

Additional Supporting Information may be found in the online version of this article:

Fig. S1. Survival of mutants isolated in screen. Representative survival assays for selected mutants and w1118 flies (control). Log-rank test analysis demonstrated a statistically significant difference between survival of control flies and mutants as noted in each graph.

Fig. S2. Survival of fadd mutants. Fractional survival of faddf02804 mutant (fadd) and w1118 flies (control) was compared. Log-rank test analysis demonstrated a statistically significant difference between survival of control flies and faddf02804 mutants (P < 0.0001).

Fig. S3. Survival of fadd/Df flies. Fractional survival of w1118 (control) and faddEY10870 mutant (fadd) flies was compared with survival of faddEY10870/Df(3R)93Fx2 flies (fadd/Df). Log-rank test analysis demonstrated a statistically significant difference between survival of faddEY10870 and that of control flies (P = 0.0116) and between faddEY10870/Df(3R)93Fx2 and control flies (P = 0.0044).

Fig. S4. Survival of dredd/Df flies. Fractional survival of w1118 (control) and dreddB118 mutant flies is compared with that of dreddB118/Df(1)R194 flies. Log-rank test analysis demonstrated a statistically significant difference between survival of dreddB118 and control flies (P < 0.0001) and between dreddB118/Df(1)R194 and control flies (P < 0.0001).

Fig. S5. Survival of traf1 mutant. Fractional survival of traf1EP5784 (traf1) mutant and w1118 flies (control) was compared. Log-rank test analysis demonstrated a statistically significant difference between survival of control flies and traf1EP5784 mutants (P < 0.0001).

table S1

Table S1. Drosophila insertion-bearing strains with reproducible phenotypes.

Acknowledgments

This work was supported by R01 AI071147 to P.I.W. C.D.B. was supported by 5 T32 AI07061-30 and 1 T32 HD055148-10A1. We thank F. Robert Jackson and Alexandra Purdy for helpful discussions and critical reading of the manuscript. We also thank A. Kopin, D. Schneider, N. Perrimon, W.J. Lee, N. Silverman, N. Baker, the Bloomington Drosophila Stock Center and The Harvard/Exelixis Stock Center for generously providing us with insertion strains and other fly stocks.

Footnotes

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

References

  1. Aggrawal K, Silverman N. Peptidoglycan recognition in Drosophila. Biochem Soc Trans. 2007;35:1496–1500. doi: 10.1042/BST0351496. [DOI] [PubMed] [Google Scholar]
  2. Baker KD, Thummel CS. Diabetic larvae and obese flies-emerging studies of metabolism in Drosophila. Cell Metab. 2007;6:257–266. doi: 10.1016/j.cmet.2007.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barnich N, Darfeuille-Michaud A. Role of bacteria in the etiopathogenesis of inflammatory bowel disease. World J Gastroenterol. 2007;13:5571–5576. doi: 10.3748/wjg.v13.i42.5571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Birmingham CL, Brumell JH. Autophagy recognizes intracellular Salmonella enterica serovar Typhimurium in damaged vacuoles. Autophagy. 2006;2:156–158. doi: 10.4161/auto.2825. [DOI] [PubMed] [Google Scholar]
  5. Birmingham CL, Smith AC, Bakowski MA, Yoshimori T, Brumell JH. Autophagy controls Salmonella infection in response to damage to the Salmonella-containing vacuole. J Biol Chem. 2006;281:11374–11383. doi: 10.1074/jbc.M509157200. [DOI] [PubMed] [Google Scholar]
  6. Blow NS, Salomon RN, Garrity K, Reveillaud I, Kopin A, Jackson FR, Watnick PI. Vibrio cholerae infection of Drosophila melanogaster mimics the human disease cholera. PLoS Pathog. 2005;1:e8. doi: 10.1371/journal.ppat.0010008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cha GH, Cho KS, Lee JH, Kim M, Kim E, Park J, et al. Discrete functions of TRAF1 and TRAF2 in Drosophila melanogaster mediated by c-Jun N-terminal kinase and NF-kappaB-dependent signaling pathways. Mol Cell Biol. 2003;23:7982–7991. doi: 10.1128/MCB.23.22.7982-7991.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chang NS, Doherty J, Ensign A, Schultz L, Hsu LJ, Hong Q. WOX1 is essential for tumor necrosis factor-, UV light-, staurosporine-, and p53-mediated cell death, and its tyrosine 33-phosphorylated form binds and stabilizes serine 46-phosphorylated p53. J Biol Chem. 2005;280:43100–43108. doi: 10.1074/jbc.M505590200. [DOI] [PubMed] [Google Scholar]
  9. Chen P, Rodriguez A, Erskine R, Thach T, Abrams JM. Dredd, a novel effector of the apoptosis activators reaper, grim, and hid in Drosophila. Dev Biol. 1998;201:202–216. doi: 10.1006/dbio.1998.9000. [DOI] [PubMed] [Google Scholar]
  10. Daborn PJ, Lumb C, Boey A, Wong W, Ffrench-Constant RH, Batterham P. Evaluating the insecticide resistance potential of eight Drosophila melanogaster cytochrome P450 genes by transgenic over-expression. Insect Biochem Mol Biol. 2007;37:512–519. doi: 10.1016/j.ibmb.2007.02.008. [DOI] [PubMed] [Google Scholar]
  11. Deretic V. Autophagy, an immunologic magic bullet: mycobacterium tuberculosis phagosome maturation block and how to bypass it. Future Microbiol. 2008;3:517–524. doi: 10.2217/17460913.3.5.517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Edelblum KL, Yan F, Yamaoka T, Polk DB. Regulation of apoptosis during homeostasis and disease in the intestinal epithelium. Inflamm Bowel Dis. 2006;12:413–424. doi: 10.1097/01.MIB.0000217334.30689.3e. [DOI] [PubMed] [Google Scholar]
  13. Erickson DL, Lines JL, Pesci EC, Venturi V, Storey DG. Pseudomonas aeruginosa relA contributes to virulence in Drosophila melanogaster. Infect Immun. 2004;72:5638–5645. doi: 10.1128/IAI.72.10.5638-5645.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Faruque SM, Albert MJ, Mekalanos JJ. Epidemiology, genetics, and ecology of toxigenic Vibrio cholerae. Microbiol Mol Biol Rev. 1998;62:1301–1314. doi: 10.1128/mmbr.62.4.1301-1314.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ferrandon D, Imler JL, Hetru C, Hoffmann JA. The Drosophila systemic immune response: sensing and signalling during bacterial and fungal infections. Nat Rev Immunol. 2007;7:862–874. doi: 10.1038/nri2194. [DOI] [PubMed] [Google Scholar]
  16. Finnis M, Dayan S, Hobson L, Chenevix-Trench G, Friend K, Ried K, et al. Common chromosomal fragile site FRA16D mutation in cancer cells. Hum Mol Genet. 2005;14:1341–1349. doi: 10.1093/hmg/ddi144. [DOI] [PubMed] [Google Scholar]
  17. Georgel P, Naitza S, Kappler C, Ferrandon D, Zachary D, Swimmer C, et al. Drosophila immune deficiency (IMD) is a death domain protein that activates antibacterial defense and can promote apoptosis. Dev Cell. 2001;1:503–514. doi: 10.1016/s1534-5807(01)00059-4. [DOI] [PubMed] [Google Scholar]
  18. Gottar M, Gobert V, Michel T, Belvin M, Duyk G, Hoffmann JA, et al. The Drosophila immune response against Gram-negative bacteria is mediated by a peptidoglycan recognition protein. Nature. 2002;416:640–644. doi: 10.1038/nature734. [DOI] [PubMed] [Google Scholar]
  19. Ha EM, Oh CT, Bae YS, Lee WJ. A direct role for dual oxidase in Drosophila gut immunity. Science. 2005;310:847–850. doi: 10.1126/science.1117311. [DOI] [PubMed] [Google Scholar]
  20. Hacker H, Karin M. Regulation and function of IKK and IKK-related kinases. Sci STKE. 2006;2006:re13. doi: 10.1126/stke.3572006re13. [DOI] [PubMed] [Google Scholar]
  21. Haugo AJ, Watnick PI. Vibrio cholerae CytR is a repressor of biofilm development. Mol Microbiol. 2002;45:471–483. doi: 10.1046/j.1365-2958.2002.03023.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hedengren M, Asling B, Dushay MS, Ando I, Ekengren S, Wihlborg M, Hultmark D. Relish, a central factor in the control of humoral but not cellular immunity in Drosophila. Mol Cell. 1999;4:827–837. doi: 10.1016/s1097-2765(00)80392-5. [DOI] [PubMed] [Google Scholar]
  23. Hegan PS, Mermall V, Tilney LG, Mooseker MS. Roles for Drosophila melanogaster myosin IB in maintenance of enterocyte brush-border structure and resistance to the bacterial pathogen Pseudomonas entomophila. Mol Biol Cell. 2007;18:4625–4636. doi: 10.1091/mbc.E07-02-0191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Horton RM, Cai ZL, Ho SN, Pease LR. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques. 1990;8:528–535. [PubMed] [Google Scholar]
  25. Hu S, Yang X. dFADD, a novel death domain-containing adapter protein for the Drosophila caspase DREDD. J Biol Chem. 2000;275:30761–30764. doi: 10.1074/jbc.C000341200. [DOI] [PubMed] [Google Scholar]
  26. Igaki T, Kanda H, Yamamoto-Goto Y, Kanuka H, Kuranaga E, Aigaki T, Miura M. Eiger, a TNF superfamily ligand that triggers the Drosophila JNK pathway. EMBO J. 2002;21:3009–3018. doi: 10.1093/emboj/cdf306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Iliopoulos D, Guler G, Han SY, Druck T, Ottey M, McCorkell KA, Huebner K. Roles of FHIT and WWOX fragile genes in cancer. Cancer Lett. 2006;232:27–36. doi: 10.1016/j.canlet.2005.06.048. [DOI] [PubMed] [Google Scholar]
  28. Johansson KC, Metzendorf C, Soderhall K. Microarray analysis of immune challenged Drosophila hemocytes. Exp Cell Res. 2005;305:145–155. doi: 10.1016/j.yexcr.2004.12.018. [DOI] [PubMed] [Google Scholar]
  29. Kanda H, Igaki T, Kanuka H, Yagi T, Miura M. Wengen, a member of the Drosophila tumor necrosis factor receptor superfamily, is required for Eiger signaling. J Biol Chem. 2002;277:28372–28375. doi: 10.1074/jbc.C200324200. [DOI] [PubMed] [Google Scholar]
  30. Kaneko T, Yano T, Aggarwal K, Lim JH, Ueda K, Oshima Y, et al. PGRP-LC and PGRP-LE have essential yet distinct functions in the drosophila immune response to monomeric DAP-type peptidoglycan. Nat Immunol. 2006;7:715–723. doi: 10.1038/ni1356. [DOI] [PubMed] [Google Scholar]
  31. Kauppila S, Maaty WS, Chen P, Tomar RS, Eby MT, Chapo J, et al. Eiger and its receptor, Wengen, comprise a TNF-like system in Drosophila. Oncogene. 2003;22:4860–4867. doi: 10.1038/sj.onc.1206715. [DOI] [PubMed] [Google Scholar]
  32. Kawano J, Kotani T, Ogata Y, Ohtaki S, Takechi S, Nakayama T, et al. CALNUC (nucleobindin) is localized in the Golgi apparatus in insect cells. Eur J Cell Biol. 2000;79:208–217. doi: 10.1078/s0171-9335(04)70024-2. [DOI] [PubMed] [Google Scholar]
  33. Kraut R, Campos-Ortega JA. inscuteable, a neural precursor gene of Drosophila, encodes a candidate for a cytoskeleton adaptor protein. Dev Biol. 1996;174:65–81. doi: 10.1006/dbio.1996.0052. [DOI] [PubMed] [Google Scholar]
  34. Kraut R, Chia W, Jan LY, Jan YN, Knoblich JA. Role of inscuteable in orienting asymmetric cell divisions in Drosophila. Nature. 1996;383:50–55. doi: 10.1038/383050a0. [DOI] [PubMed] [Google Scholar]
  35. Lefebvre B, Formstecher P, Lefebvre P. Improvement of the gene splicing overlap (SOE) method. Biotechniques. 1995;19:186–188. [PubMed] [Google Scholar]
  36. Lemaitre B, Kromer-Metzger E, Michaut L, Nicolas E, Meister M, Georgel P, et al. A recessive mutation, immune deficiency (imd), defines two distinct control pathways in the Drosophila host defense. Proc Natl Acad Sci USA. 1995;92:9465–9469. doi: 10.1073/pnas.92.21.9465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Leopold P, Perrimon N. Drosophila and the genetics of the internal milieu. Nature. 2007;450:186–188. doi: 10.1038/nature06286. [DOI] [PubMed] [Google Scholar]
  38. Leulier F, Rodriguez A, Khush RS, Abrams JM, Lemaitre B. The Drosophila caspase Dredd is required to resist gram-negative bacterial infection. EMBO Rep. 2000;1:353–358. doi: 10.1093/embo-reports/kvd073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Liehl P, Blight M, Vodovar N, Boccard F, Lemaitre B. Prevalence of local immune response against oral infection in a Drosophila/Pseudomonas infection model. PLoS Pathog. 2006;2:e56. doi: 10.1371/journal.ppat.0020056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lin P, Le-Niculescu H, Hofmeister R, McCaffery JM, Jin M, Hennemann H, et al. The mammalian calcium-binding protein, nucleobindin (CALNUC), is a Golgi resident protein. J Cell Biol. 1998;141:1515–1527. doi: 10.1083/jcb.141.7.1515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Lu Y, Wu LP, Anderson KV. The antibacterial arm of the drosophila innate immune response requires an IkappaB kinase. Genes Dev. 2001;15:104–110. doi: 10.1101/gad.856901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Mansfield BE, Dionne MS, Schneider DS, Freitag NE. Exploration of host–pathogen interactions using Listeria monocytogenes and Drosophila melanogaster. Cell Microbiol. 2003;5:901–911. doi: 10.1046/j.1462-5822.2003.00329.x. [DOI] [PubMed] [Google Scholar]
  43. Mimuro H, Suzuki T, Nagai S, Rieder G, Suzuki M, Nagai T, et al. Helicobacter pylori dampens gut epithelial self-renewal by inhibiting apoptosis, a bacterial strategy to enhance colonization of the stomach. Cell Host Microbe. 2007;2:250–263. doi: 10.1016/j.chom.2007.09.005. [DOI] [PubMed] [Google Scholar]
  44. Minarowska A, Minarowski L, Karwowska A, Gacko M. Regulatory role of cathepsin D in apoptosis. Folia Histochem Cytobiol. 2007;45:159–163. [PubMed] [Google Scholar]
  45. Moriarty KJ, Turnberg LA. Bacterial toxins and diarrhoea. Clin Gastroenterol. 1986;15:529–543. [PubMed] [Google Scholar]
  46. Nehme NT, Liegeois S, Kele B, Giammarinaro P, Pradel E, Hoffmann JA, et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS Pathog. 2007;3:e173. doi: 10.1371/journal.ppat.0030173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Orvedahl A, Levine B. Eating the enemy within: autophagy in infectious diseases. Cell Death Differ. 2008:1–13. doi: 10.1038/cdd.2008.130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Otte S, Barnikol-Watanabe S, Vorbruggen G, Hilschmann N. NUCB1, the Drosophila melanogaster homolog of the mammalian EF-hand proteins NEFA and nucleobindin. Mech Dev. 1999;86:155–158. doi: 10.1016/s0925-4773(99)00103-3. [DOI] [PubMed] [Google Scholar]
  49. Park SY, Heo YJ, Kim KS, Cho YH. Drosophila melanogaster is susceptible to Vibrio cholerae infection. Mol Cells. 2005;20:409–415. [PubMed] [Google Scholar]
  50. Pegg AE. S-adenosylmethionine decarboxylase: a brief review. Cell Biochem Funct. 1984;2:11–15. doi: 10.1002/cbf.290020105. [DOI] [PubMed] [Google Scholar]
  51. Py BF, Lipinski MM, Yuan J. Autophagy limits Listeria monocytogenes intracellular growth in the early phase of primary infection. Autophagy. 2007;3:117–125. doi: 10.4161/auto.3618. [DOI] [PubMed] [Google Scholar]
  52. Rutschmann S, Jung AC, Zhou R, Silverman N, Hoffmann JA, Ferrandon D. Role of Drosophila IKK gamma in a toll-independent antibacterial immune response. Nat Immunol. 2000a;1:342–347. doi: 10.1038/79801. [DOI] [PubMed] [Google Scholar]
  53. Rutschmann S, Jung AC, Hetru C, Reichhart JM, Hoffmann JA, Ferrandon D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 2000b;12:569–580. doi: 10.1016/s1074-7613(00)80208-3. [DOI] [PubMed] [Google Scholar]
  54. Ryu JH, Ha EM, Oh CT, Seol JH, Brey PT, Jin I, et al. An essential complementary role of NF-kappaB pathway to microbicidal oxidants in Drosophila gut immunity. EMBO J. 2006;25:3693–3701. doi: 10.1038/sj.emboj.7601233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Schneider DS, Ayres JS, Brandt SM, Costa A, Dionne MS, Gordon MD, et al. Drosophila eiger mutants are sensitive to extracellular pathogens. PLoS Pathog. 2007;3:e41. doi: 10.1371/journal.ppat.0030041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Seiler N, Raul F. Polyamines and apoptosis. J Cell Mol Med. 2005;9:623–642. doi: 10.1111/j.1582-4934.2005.tb00493.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Sipos F, Molnar B, Zagoni T, Berczi L, Tulassay Z. Growth in epithelial cell proliferation and apoptosis correlates specifically to the inflammation activity of inflammatory bowel diseases: ulcerative colitis shows specific p53- and EGFR expression alterations. Dis Colon Rectum. 2005;48:775–786. doi: 10.1007/s10350-004-0831-5. [DOI] [PubMed] [Google Scholar]
  58. Song J, Tanouye MA. From bench to drug: Human seizure modeling using Drosophila. Prog Neurobiol. 2008;84:182–191. doi: 10.1016/j.pneurobio.2007.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Stoven S, Ando I, Kadalayil L, Engstrom Y, Hultmark D. Activation of the Drosophila NF-kappaB factor Relish by rapid endoproteolytic cleavage. EMBO Rep. 2000;1:347–352. doi: 10.1093/embo-reports/kvd072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Stoven S, Silverman N, Junell A, Hedengren-Olcott M, Erturk D, Engstrom Y, et al. Caspase-mediated processing of the Drosophila NF-kappaB factor Relish. Proc Natl Acad Sci USA. 2003;100:5991–5996. doi: 10.1073/pnas.1035902100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Suzuki T, Nunez G. A role for Nod-like receptors in autophagy induced by Shigella infection. Autophagy. 2008;4:73–75. doi: 10.4161/auto.5101. [DOI] [PubMed] [Google Scholar]
  62. Takehana A, Yano T, Mita S, Kotani A, Oshima Y, Kurata S. Peptidoglycan recognition protein (PGRP)-LE and PGRP-LC act synergistically in Drosophila immunity. EMBO J. 2004;23:4690–4700. doi: 10.1038/sj.emboj.7600466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Tanji T, Ip YT. Regulators of the Toll and Imd pathways in the Drosophila innate immune response. Trends Immunol. 2005;26:193–198. doi: 10.1016/j.it.2005.02.006. [DOI] [PubMed] [Google Scholar]
  64. Thibault ST, Singer MA, Miyazaki WY, Milash B, Dompe NA, Singh CM, et al. A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat Genet. 2004;36:283–287. doi: 10.1038/ng1314. [DOI] [PubMed] [Google Scholar]
  65. Vergne I, Singh S, Roberts E, Kyei G, Master S, Harris J, et al. Autophagy in immune defense against Mycobacterium tuberculosis. Autophagy. 2006;2:175–178. doi: 10.4161/auto.2830. [DOI] [PubMed] [Google Scholar]
  66. Vidal S, Khush RS, Leulier F, Tzou P, Nakamura M, Lemaitre B. Mutations in the Drosophila dTAK1 gene reveal a conserved function for MAPKKKs in the control of rel/NF-kappaB-dependent innate immune responses. Genes Dev. 2001;15:1900–1912. doi: 10.1101/gad.203301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Vodovar N, Vinals M, Liehl P, Basset A, Degrouard J, Spellman P, et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proc Natl Acad Sci USA. 2005;102:11414–11419. doi: 10.1073/pnas.0502240102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Waldor MK, Mekalanos JJ. Emergence of a new cholera pandemic: molecular analysis of virulence determinants in Vibrio cholerae O139 and development of a live vaccine prototype. J Infect Dis. 1994;170:278–283. doi: 10.1093/infdis/170.2.278. [DOI] [PubMed] [Google Scholar]
  69. Watson AJ. Apoptosis and colorectal cancer. Gut. 2004;53:1701–1709. doi: 10.1136/gut.2004.052704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Williams-Ashman HG, Janne J, Coppoc GL, Geroch ME, Schenone A. New aspects of polyamine biosynthesis in eukaryotic organisms. Adv Enzyme Regul. 1972;10:225–245. doi: 10.1016/0065-2571(72)90016-7. [DOI] [PubMed] [Google Scholar]
  71. van der Woude CJ, Kleibeuker JH, Jansen PL, Moshage H. Chronic inflammation, apoptosis and (pre-)malignant lesions in the gastro-intestinal tract. Apoptosis. 2004;9:123–130. doi: 10.1023/B:APPT.0000018794.26438.22. [DOI] [PubMed] [Google Scholar]
  72. Yano T, Kurata S. Induction of autophagy via innate bacterial recognition. Autophagy. 2008;4:958–960. doi: 10.4161/auto.6802. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S2

Table S2. Drosophila strains used in this study.

NIHMS82744-supplement-Table_S2.pdf (24.8KB, pdf)
supplementary. Supporting information.

Additional Supporting Information may be found in the online version of this article:

Fig. S1. Survival of mutants isolated in screen. Representative survival assays for selected mutants and w1118 flies (control). Log-rank test analysis demonstrated a statistically significant difference between survival of control flies and mutants as noted in each graph.

Fig. S2. Survival of fadd mutants. Fractional survival of faddf02804 mutant (fadd) and w1118 flies (control) was compared. Log-rank test analysis demonstrated a statistically significant difference between survival of control flies and faddf02804 mutants (P < 0.0001).

Fig. S3. Survival of fadd/Df flies. Fractional survival of w1118 (control) and faddEY10870 mutant (fadd) flies was compared with survival of faddEY10870/Df(3R)93Fx2 flies (fadd/Df). Log-rank test analysis demonstrated a statistically significant difference between survival of faddEY10870 and that of control flies (P = 0.0116) and between faddEY10870/Df(3R)93Fx2 and control flies (P = 0.0044).

Fig. S4. Survival of dredd/Df flies. Fractional survival of w1118 (control) and dreddB118 mutant flies is compared with that of dreddB118/Df(1)R194 flies. Log-rank test analysis demonstrated a statistically significant difference between survival of dreddB118 and control flies (P < 0.0001) and between dreddB118/Df(1)R194 and control flies (P < 0.0001).

Fig. S5. Survival of traf1 mutant. Fractional survival of traf1EP5784 (traf1) mutant and w1118 flies (control) was compared. Log-rank test analysis demonstrated a statistically significant difference between survival of control flies and traf1EP5784 mutants (P < 0.0001).

NIHMS82744-supplement-supplementary.ppt (163KB, ppt)
table S1

Table S1. Drosophila insertion-bearing strains with reproducible phenotypes.

NIHMS82744-supplement-table_S1.doc (50KB, doc)

RESOURCES