Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2000 Jul;121(1):77–85. doi: 10.1046/j.1365-2249.2000.01269.x

Effects of secretory leucocyte protease inhibitor on the production of the anti-inflammatory cytokines, IL-10 and transforming growth factor-beta (TGF-β), by lipopolysaccharide-stimulated macrophages

C Sano *,†, T Shimizu *, K Sato *, H Kawauchi †, H Tomioka *
PMCID: PMC1905674  PMID: 10886242

Abstract

We studied the effects of secretory leucocyte protease inhibitor (SLPI) on the production of the anti-inflammatory cytokines, IL-10 and TGF-β, by lipopolysaccharide (LPS)-stimulated macrophages, using half-sized SLPI (1/2 SLPI) containing the C-terminal domain (Arg58-Ala107). ELISA testing of macrophage culture fluids showed a temporary production of IL-10 by the macrophages in the early phase (24 h) after LPS stimulation at low (1 ng/ml) or high (10 μg/ml) concentrations. On the other hand, TGF-β production was initiated after day 3 and progressively increased. 1/2 SLPI significantly increased IL-10 and TGF-β production by macrophages in response to a low dose as well as a high dose of LPS. Reverse transcription-polymerase chain reaction analysis showed that 1/2 SLPI caused a significant increase in the expression of both IL-10 and TGF-β mRNAs by LPS-stimulated macrophages. Thus, although the profile of macrophage TGF-β production by LPS-stimulated macrophages is markedly different from that of their IL-10 production, SLPI causes an up-regulation of the production of these anti-inflammatory cytokines by LPS-stimulated macrophages.

Keywords: macrophage, IL-10, transforming growth factor-beta, secretory leucocyte protease inhibitor

INTRODUCTION

Secretory leucocyte protease inhibitor (SLPI), a potent serine protease inhibitor in the lungs, which is secreted by bronchial and alveolar epithelial cells [1–3] and inhibits a wide range of proteases including neutrophil elastase and cathepsin G, plays an important role in protection of the airway epithelial surface in the lungs from attack by neutrophil-derived proteases generated at the sites of inflammatory reactions [2,4]. It was also reported that SLPI down-regulated the ability of macrophages in producing prostaglandin H synthase-2 and prostaglandin E2 and that the suppressive effects of SLPI were independent of its anti-protease activity [5]. On the other hand, we recently found that SLPI up-regulated the production of an anti-inflammatory cytokine, IL-10 [6–8], by macrophages in response to mycobacterial infection [9]. Therefore, it is of interest to examine whether or not SLPI modulates the production of IL-10 by macrophages in response to stimulation with lipopolysaccharide (LPS) derived from Escherichia coli, a representative Gram-negative common bacterium. Moreover, we studied the profiles of macrophage production of another anti-inflammatory cytokine, TGF-β[10–12], during long-term cultivation after LPS stimulation, when cultured in the presence or absence of SLPI.

MATERIALS AND METHODS

SLPI preparation

A recombinant half-sized human SLPI (1/2 SLPI) containing the C-terminal domain (Arg58-Ala107) of SLPI [13–15] was obtained from Teijin Ltd (Tokyo, Japan) and used as a SLPI preparation for experiments. The anti-protease activity of native SLPI is almost completely retained in the 1/2 SLPI, except that the latter is more specific for elastase than for trypsin [13–16]. Although the overall amino acid identity of mature human and mouse SLPIs is 52%, there are striking structural similarities between human and mouse SLPIs, in that both SLPIs reveal boomerang-shaped molecules comprising two topologically superimposable domains [4,17]. Moreover, the abundance of proline (12 per 107 residues) in human SLPI is also shared by mouse SLPI (11 per 106 residues) [18]. In addition, the human 1/2 SLPI is highly active against serine proteases of animals other than humans [16] and also efficacious in ameliorating chemically induced pulmonary fibrosis in hamsters [19]. Thus, the present 1/2 SLPI exerted its action not only in humans but also in mice, even in cross-species testing.

Special agents

Recombinant mouse IL-10, ultrapure natural human TGF-β, rat anti-mouse IL-10 MoAb, and mouse anti-human TGF-β MoAb were purchased from Genzyme Co. (Cambridge, MA). Biotinylated rat anti-mouse IL-10 MoAb was supplied by PharMingen (San Diego, CA). Chicken anti-human TGF-β MoAb was purchased from R&D Systems Inc. (Minneapolis, MN), and alkaline phosphatase-conjugated rabbit anti-chicken/turkey IgG antibody was obtained from Zymed Labs Inc. (San Francisco, CA). Alkaline phosphatase-conjugated streptavidin was supplied by Life Technologies Co. (Gaithersburg, MD) and p-nitrophenyl phosphate tablets were obtained from Sigma Chemical Co. (St Louis, MO).

Medium

RPMI 1640 medium supplemented with 25 mm HEPES, 2 mm glutamine, 100 μg/ml streptomycin, 100 U/ml penicillin G, and 10% heat-inactivated fetal bovine serum (FBS; BioWhittaker Co., Walkersville, MD) was used.

Cytokine production by macrophages

Peritoneal cells (2·0 × 107) from BALB/c mice, 8 to 10 weeks old (Japan Clea Co., Osaka, Japan) were suspended in 8 ml of culture medium and poured onto 14-mm plastic culture sheets (Wako Phamaceutical Industry, Osaka, Japan) which were put on 90-mm cell culture plate, unless otherwise specified. After incubating at 37°C for 2 h in a CO2 incubator, plastic sheets were withdrawn, rinsed in 2% FBS–Hanks' balanced salt solution (HBSS) to remove non-adherent cells, then immersed in 16-mm culture wells (Becton Dickinson, Lincoln Park, NJ) containing culture medium, and used as macrophage monolayer cultures. This method gave > 95% pure macrophage monolayer cultures. The resultant macrophage monolayer cultures were immersed in 1·0 ml of culture medium with or without the addition of 1 ng/ml or 10 μg/ml of LPS (E. coli O111:B4; Sigma) in 16-mm culture wells, and cultured in the presence or absence of 0·1 or 1·0 μg/ml of 1/2 SLPI at 37°C in a CO2 incubator for up to 7 days. At intervals, the macrophage culture fluids were removed and measured for cytokine concentrations, as previously described [20].

Briefly, Immulon 4 plates (Dynatech Labs, Chantilly, VA) were coated with a capture antibody for each cytokine using rat anti-mouse IL-10 antibody or mouse anti-human TGF-β antibody (also specific to mouse TGF-β). After blocking of capture antibody-coated wells with 1% bovine serum albumin (BSA; Sigma) dissolved in PBS and subsequent 0·1% BSA–PBS, the sample culture fluids (100 μl) were poured onto the wells coated with each of the capture antibodies, and individual cytokines contained in the macrophage culture fluids were allowed to bind to corresponding capture antibodies. After rinsing the wells with 0·1% BSA–PBS, either biotinylated rat anti-mouse IL-10 antibody or chicken anti-human TGF-β atibody was added as the detecting antibodies and allowed to react with the complex consisting of corresponding cytokines and capture antibodies. In the case of the IL-10 assay, after binding of alkaline phosphatase-conjugated streptavidin to the resultant complex consisting of the biotinylated detecting antibody, cytokine, and capture antibody, colour development was performed using p-nitrophenyl phosphate tablets as the substrate. In the case of the TGF-β assay, after binding of alkaline phosphatase-conjugated rabbit anti-chicken/turkey IgG antibody to the complex consisting of the detecting chicken anti-human TGF-β antibody, TGF-β, and capture antibody, colour development was performed using p-nitrophenyl phosphate tablets (Sigma) as a substrate.

Our ELISA system for TGF-β could detected only active form TGF-β molecules, but not latent TGF-β which is non-covalently associated with the 75-kD glycosylated latency-associated protein [11]. Therefore, sample macrophage culture fluids were subjected to acid treatment with 1 n HCl for 30 min before ELISA testing [21], unless otherwise specified.

Macrophage expression of IL-10 and TGF-β mRNAs

Macrophage monolayer cultures prepared by seeding 5 × 106 of peritoneal cells (PC) were cultured in a 60-mm culture dish (Becton Dickinson) in 5 ml of culture medium containing 10 μg/ml of LPS in the presence or absence of 1 μg/ml of 1/2 SLPI. Total RNA was isolated from cultured macrophages using the ISOGEN kit (Nippon Gene Co., Toyama, Japan). After DNase I (Gibco BRL Co., Rockville, MD) treatment (1 U DNase/μg of RNA sample) at room temperature for 15 min, the resultant RNA samples were reverse transcribed to the first chain of cDNA using oligo dT primers (Gibco) and 200 U Superscript II reverse transcriptase (Gibco) with the standard reaction mixture (20 μl): 1 × reverse transcription buffer pH 8·3, 1 mm each dNTP including dATP, dCTP, dGTP and dTTP (Gibco), and 2·0 U of RNase inhibitor (Gibco). After 1 h reaction at 42°C and subsequent heating at 72°C for 15 min, 1 μl of aliquots of resultant cDNA were amplified specifically by polymerase chain reaction (PCR) in the standard reaction mixture (50 μl) containing 1 × PCR buffer pH 8·3, 0·2 mm of each dNTP, 1 U of Taq polymerase (Takara Biomedicals Co., Tokyo, Japan), and 20 pmol of sense and antisense primers for IL-10 and TGF-β1 (synthesized by Greiner Labortecknik Co., Tokyo, Japan) as follows: (sense/antisense): IL-10, TGACTGGCATGAGGATCAGCAG/ATCCTGAGGGTCTTCAGCTT; TGF-β, AGCCCTGGATACCAACTATTGCTTCAG- CTCCACAG/AGGGGCGGGGCGGGGCGGGGCTTCAGCTGC. Reactions were carried out in a DNA Thermal Cycler (ASTEC Corp., Fukuoka, Japan) for 25 cycles including denaturing at 94°C for 1 min, annealing at 58°C for 2 min, and extension at 72°C for 2 min for each cycle. PCR products were analysed by electrophoresis on 2% ethidium bromide-stained agarose gels.

Quantitative reverse transcriptase (RT)-PCR was performed according to the method of Zhao et al. [22], in order to strictly normalize the amounts of cDNAs for IL-10 and TGF-β to the amount of β-actin cDNA in each specimen. Briefly, we performed parallel PCRs for the cytokines and β-actin on serial two-fold dilutions of cDNA from each macrophage culture to determine the highest titre of cDNA yielding a positive PCR for each message. Numerical values for IL-10 and TGF-β expression in each macrophage culture were derived from ‘the ratio’ of the last dilution giving a positive PCR for each cytokine divided by the last dilution giving a positive PCR for β-actin. The obtained values of ‘the ratio’ for IL-10 and TGF-β messages in macrophages cultured for prescribed intervals (2 h, 6 h, 24 h, 7 days) were further multiplied by the reciprocal of ‘the ratio’ for the corresponding cytokine in macrophages at 0 time (32 and 8 for IL-10 and TGF-β, respectively) in order to fix the 0-time value of ‘the ratio’ for each cytokine as 1. This gave ‘relative intensity’ of mRNA expression of test cytokines by macrophages cultured for various intervals after LPS stimulation.

Statistical analysis

Statistical analysis was performed using Student's t-test.

RESULTS

Effects of 1/2 SLPI on IL-10 production by LPS-stimulated macrophages

First, we examined the effects of 1/2 SLPI on macrophage production of an anti-inflammatory cytokine IL-10 [6–8] in response to LPS stimulation (Fig. 1). IL-10 production by resident macrophages transiently increased at 24 h after LPS stimulation and thereafter declined, reaching normal levels by day 5 (data not shown). Differing from the case of tumour necrosis factor-alpha (TNF-α) production (data not shown), a similar increase in IL-10 production was observed for macrophages stimulated with either low-dose (1 ng/ml) or high-dose (10 μg/ml) LPS. 1/2 SLPI significantly increased IL-10 production when it was added at 0·1 or 1 μg/ml (P < 0·01). 1/2 SLPI caused a somewhat larger increase in IL-10 production by macrophages in response to the low-dose LPS than in the case of macrophages stimulated with high-dose LPS.

Fig. 1.

Fig. 1

Open in a new tab

Effects of half-sized secretory leucocyte protease inhibitor (1/2 SLPI) on the production of IL-10 by lipopolysaccharide (LPS)-stimulated macrophages. Resident macrophages were cultured in the medium with or without the addition of 1 ng/ml or 10 μg/ml of LPS in the presence or absence of indicated concentrations of 1/2 SLPI for 24 h. Each bar indicates the mean ± s.e.m. (n = 3). *Significantly larger than the values of macrophages which were not given 1/2 SLPI treatment (P < 0·01).

We further examined the effects of 1/2 SLPI on the stability of IL-10 in the macrophage culture fluids, in particular the activity of 1/2 SLPI in preventing macrophagial protease-mediated degradation of IL-10 due to its anti-protease action. The 12-h culture fluids of LPS-stimulated macrophages containing 8·1 ng/ml of IL-10 (about a half was exogenously added IL-10) were incubated in the presence or absence of 1 μg/ml of 1/2 SLPI at 37°C for 24 h, and the residual amounts of IL-10 were measured by ELISA. No significant degradation of IL-10 was observed during 24 h incubation of the macrophage culture fluids with or without the addition of 1/2 SLPI, as follows: 0-time, 8·1 ± 0·6 ng/ml; after 24 h in the absence of 1/2 SLPI, 7·5 ± 0·4 ng/ml; after 24 h in the presence of 1/2 SLPI, 8·0 ± 0·3 ng/ml. This finding excludes the possibility that 1/2 SLPI was simply preventing the degradation of IL-10 produced in the macrophage culture fluid.

Effects of 1/2 SLPI on TGF-β production by LPS-stimulated macrophages

In the next series of experiments, we examined the effects of 1/2 SLPI on macrophage production of another anti-inflammatory cytokine, TGF-β[10–12] in response to LPS stimulation. Figure 2 shows the effects of 1/2 SLPI on the production of whole TGF-β (active form + latent form) by resident macrophages. In this experiment, sample macrophage culture fluids were subjected to acid treatment with 1 n HCl, which converts the latent form TGF-β to the active form TGF-β by removing latency-associated protein [11,21]. LPS at the low (1 ng/ml) and high (10 μg/ml) concentrations induced the accumulation of whole TGF-β at day 7 of macrophage cultivation in a dose-dependent fashion, although such an increase was not noted during the first 3 days after LPS stimulation (data not shown for day 1). In the case of macrophages stimulated with low-dose LPS, 1/2 SLPI at 0·1 μg/ml significantly increased TGF-β production at day 3 and day 7 (P < 0·01 or P < 0·05). 1/2 SLPI at 1 μg/ml also significantly increased the whole TGF-β accumulation by macrophages in response to the high-dose LPS at day 7 (P < 0·05).

Fig. 2.

Fig. 2

Open in a new tab

Effects of half-sized secretory leucocyte protease inhibitor (1/2 SLPI) on the production of whole TGF-β (active form + latent form) by lipopolysaccharide (LPS)-stimulated macrophages. Resident macrophages were cultured in the medium with or without the addition of 1 ng/ml or 10 μg/ml of LPS in the presence or absence of indicated concentrations of 1/2 SLPI. Culture fluid specimens were subjected to TGF-β assay after acid treatment. Each bar indicates the mean ± s.e.m. (n = 3). Significantly greater than the values of macrophages which were not given 1/2 SLPI treatment: *P < 0·05; **P < 0·01.

Figure 3 shows the effects of 1/2 SLPI on the production of the active form of TGF-β by macrophages stimulated with high-dose (10 μg/ml) LPS. In this case, a small increase in TGF-β production was observed after day 7 of macrophage cultivation. Such an increase was not observed during the first 3 days (data not shown). 1/2 SLPI increased macrophage production of the active form of TGF-β moderately at day 7 and much more strongly at day 14 (P < 0·01 or P < 0·05).

Fig. 3.

Fig. 3

Open in a new tab

Effects of half-sized secretory leucocyte protease inhibitor (1/2 SLPI) on the production of active form TGF-β by lipopolysaccharide (LPS)-stimulated macrophages. Resident macrophages were cultured in the medium with or without the addition of 10 μg/ml LPS in the presence or absence of indicated concentrations of 1/2 SLPI. Culture fluid specimens were subjected to TGF-β assay without acid treatment. Each bar indicates the mean ± s.e.m. (n = 5). Significantly greater than the values of macrophages which were not given 1/2 SLPI treatment: *P < 0·05; **P < 0·01.

We further examined the effects of 1/2 SLPI on the stability of TGF-β in the macrophage culture fluids, in particular the activity of 1/2 SLPI in preventing macrophagial protease-mediated degradation of TGF-β due to its anti-protease action. The 12-h culture fluids of LPS-stimulated macrophages containing 3·3 ng/ml of TGF-β (mostly exogenously added TGF-β) were incubated in the presence or absence of 1 μg/ml of 1/2 SLPI at 37°C for 24 h, and the residual amounts of the active form of TGF-β were measured by ELISA. When the 0-time amount was fixed as 100%, relative amounts of the active form of TGF-β somewhat increased during 24 h incubation of the macrophage culture fluids (presumably due to the action of macrophage-derived converting factors [11]) as follows: 128 ± 30% and 133 ± 36% in the presence and absence of 1/2 SLPI, respectively. Notably, 1/2 SLPI did not facilitate such a phenomenon. Therefore, the possibility is excluded that 1/2 SLPI was simply preventing the degradation of TGF-β in the macrophage culture fluid or promoting the conversion of the latent form of TGF-β to the active form of TGF-β.

Effects of 1/2 SLPI on IL-10 mRNA expression by LPS-stimulated macrophages

In order to find the mechanism of 1/2 SLPI-mediated increase in macrophage production of IL-10 during the early phase of cultivation, we examined the effects of 1/2 SLPI on the expression of IL-10 mRNA by LPS-stimulated macrophages. As indicated in Fig. 4a,b (Expt 1), macrophage IL-10 mRNA expression increased in response to LPS stimulation, peaking at 6 h, and a prolonged expression of IL-10 mRNA was seen even at 24 h. IL-10 mRNA expression was completely abolished by day 7. When macrophages were cultured in the presence of 1/2 SLPI at 1 μg/ml, a much more rapid and potent increase in macrophage IL-10 mRNA expression was observed after LPS stimulation than in the case of macrophages cultured in the absence of 1/2 SLPI. 1/2 SLPI-treated macrophages showed potently increased IL-10 mRNA expression as early as 2 h, thereafter gradually increasing until 24 h after LPS stimulation.

Fig. 4.

Fig. 4

Open in a new tab

Effects of half-sized secretory leucocyte protease inhibitor (1/2 SLPI) on the expression of IL-10 mRNA by lipopolysaccharide (LPS)-stimulated macrophages. Resident macrophages were cultured in the medium containing 10 μg/ml of LPS in the presence or absence of 1·0 μg/ml of 1/2 SLPI for up to 7 days. (a) Macrophage IL-10 mRNA expression measured by the ordinary reverse transcriptase-polymerase chain reaction (RT-PCR) (Expt 1). (b) From the data presented in (a), macrophage IL-10 mRNA expression in the presence (hatched bars) or absence (▪) of 1/2 SLPI was normalized for β-actin mRNA expression. (c) Macrophage IL-10 mRNA expression measured by the quantitative RT-PCR (Expt 2).

These findings were confirmed by another experiment (Expt 2) using the quantitative RT-PCR method (Fig. 4c). In this case, 1/2 SLPI at 1 μg/ml caused a two-to-four-fold increase in IL-10 mRNA expression by macrophages during 2 h to 24 h after LPS stimulation. The effect of 1/2 SLPI was most marked at 2 h, yielding a four-fold increase in IL-10 mRNA expression. In summary, 1/2 SLPI treatment of macrophages caused an accelerated and potentiated expression of IL-10 mRNA by macrophages after LPS stimulation.

Effects of 1/2 SLPI on TGF-β mRNA expression by LPS-stimulated macrophages

In order to discover the mechanism of 1/2 SLPI-mediated increase in macrophage production of TGF-β during the middle to late phase of cultivation, we examined the effects of 1/2 SLPI on the expression of TGF-β mRNA by LPS-stimulated macrophages. As indicated in Fig. 5, TGF-β mRNA was constitutively expressed in resident peritoneal macrophages even after 24 h resting cultivation, while the same macrophages showed a minimal expression of mRNAs of other cytokines such as IL-10 (Fig. 4) and TNF-α (data not shown). This is consistent with the finding by Assoian et al. [23] that TGF-β mRNA is expressed in unactivated human monocytes and alveolar macrophages at a level similar to that in LPS-activated macrophages, although secretion of TGF-β is induced by LPS stimulation of macrophages.

Fig. 5.

Fig. 5

Open in a new tab

Effects of half-sized secretory leucocyte protease inhibitor (1/2 SLPI) on the expression of TGF-β mRNA by lipopolysaccharide (LPS)-stimulated macrophages. Resident macrophages were cultured in the medium containing 10 μg/ml of LPS in the presence or absence of 1·0 μg/ml of 1/2 SLPI for up to 7 days. (a) Macrophage TGF-β mRNA expression measured by the ordinary reverse transcriptase-polymerase chain reaction (RT-PCR) (Expt 1). (b) From the data presented in (a), macrophage TGF-β mRNA expression in the presence (hatched bars) or absence (▪) of 1/2 SLPI was normalized for β-actin mRNA expression. (c) Macrophage TGF-β mRNA expression measured by the quantitative RT-PCR (Expt 2).

As shown in Fig. 5a,b (Expt 1), when LPS-stimulated macrophages were cultured in the absence of 1/2 SLPI, intramacrophagial levels of TGF-β mRNA gradually increased during the first 10 h after LPS stimulation and peaked at 10 h, followed by a decline reaching nearly the base line level by 24 h, and thereafter showed further decrease until day 7. When macrophages were cultured in the presence of 1/2 SLPI at 1 μg/ml, a much more rapid and intense increase in macrophage TGF-β mRNA expression was observed in response to LPS stimulation than with macrophages not receiving the 1/2 SLPI treatment. That is, 1/2 SLPI-treated macrophages showed a potent increase in TGF-β mRNA expression as early as 2 h after LPS stimulation, reaching a peak at 6 h. The increased level of TGF-β mRNA was retained for at least 24 h after LPS stimulation, thereafter decreasing to the base line level by day 7.

These findings were confirmed by another experiment (Expt 2) using the quantitative RT-PCR method (Fig. 5c). In this case, 1/2 SLPI caused a two-to-four-fold increase in TGF-β mRNA expression by macrophages during 2–24 h after LPS stimulation. The effect of 1/2 SLPI was the greatest at 2 h and 6 h, yielding a four-fold increase in TGF-β mRNA expression. In summary, 1/2 SLPI caused an accelerated, potentiated and prolonged expression of TGF-β mRNA by macrophages after LPS stimulation.

DISCUSSION

The present study using peritoneal macrophages from BALB/c strain mice indicated that 1/2 SLPI moderately or potently up-regulated the production of anti-inflammatory cytokines, IL-10 and TGF-β, by macrophages in response to LPS stimulation. The same result was obtained for macrophages from CBA/JN strain mice (unpublished observation). Notably, 1/2 SLPI up-regulated macrophage production of both cytokines in response to not only low-dose (1 ng/ml) LPS but also to high-dose (10 μg/ml) LPS. This implies that SLPI-mediated signals can cross-talk with both the signal transduction pathways dependent on a high-affinity LPS receptor CD14 [24] and low-affinity LPS receptors, CD11c/CD18 and p73 [25,26]. In our previous study, 1/2 SLPI increased IL-10 production by macrophages in response to mycobacterial infection, while it did not modulate their TGF-β production [9]. This profile is somewhat different from that which was observed for LPS-stimulated macrophages in the present study. This discrepancy can be explained by the fact that the major macrophage receptors for mycobacterial binding are complement receptors, mannose receptors, and Sp-A receptors [27–29], differing from the case of the LPS binding to macrophages, which is mainly dependent on CD14, CD11c/18, and p73 [24–26].

In response to LPS (10 μg/ml) stimulation, macrophage IL-10 mRNA expression was rapidly up-regulated, peaking at 6 h, and the elevated expression of IL-10 mRNA was retained at least for 24 h. 1/2 SLPI elevated the expression of IL-10 mRNA by LPS-stimulated macrophages (Fig. 4). Therefore, it appears that the 1/2 SLPI-mediated increase in IL-10 production by LPS-stimulated macrophages at 24 h (Fig. 1) was partly attributable to 1/2 SLPI-mediated up-regulation of IL-10 mRNA transcription.

Although the expression of TGF-β mRNA was rapidly increased during the first 10 h after LPS stimulation (Fig. 5), the LPS-induced increase in macrophage TGF-β production at a protein level was not observed until day 7, as indicated in Fig. 2. This may mean that post-transcriptional regulation is important for TGF-β expression at a protein level in LPS-stimulated macrophages. It is also noted that 1/2 SLPI moderately increased the whole (active form + latent form) TGF-β production by LPS-stimulated macrophages in the middle phase (day 7) of macrophage cultivation (Fig. 2). This is partly attributable to the 1/2 SLPI-mediated increase in the stability of TGF-β mRNA expression by LPS-stimulated macrophages, as shown in Fig. 5. In addition, as indicated in Fig. 3, 1/2 SLPI increased macrophage production of the active form of TGF-β in the late periods (day 7 to day 14). Thus, there is the possibility that 1/2 SLPI enhanced macrophage production of certain factors, such as plasmin, cathepsin, and sialidases, which convert the latent form of TGF-β to the active form of TGF-β[10], since inflammatory macrophages and interferon-gamma (IFN-γ)-activated macrophages produce such proteases and sialidases within an acidic microenvironment [30,31].

In any case, this is as far as we know the first study to demonstrate the SLPI-mediated up-regulation of macrophage production of IL-10 and TGF-β. In addition to inhibiting proteolytic tissue destruction, SLPI is evidenced to have multiple anti-inflammatory actions in vivo, particularly suppressive activity against the inflammation and joint damage of certain types of arthritis [32]. The present findings indicate that the in vivo anti-inflammatory effects of SLPI are partly attributable to its up-regulating effects on macrophage production of anti-inflammatory cytokines, IL-10 and TGF-β. It is of interest whether or not the modulating effects of 1/2 SLPI on macrophage cytokine production are produced due to signal transduction via 1/2 SLPI-specific receptors on the macrophage cell membrane. Further studies are currently underway on this point.

Acknowledgments

This study was supported in part by grants from the Ministry of Education, Science and Culture of Japan, the Ministry of Public Welfare of Japan, and from the US–Japan Cooperative Medical Science Program. We thank Teijin Limited for providing half-sized SLPI.

REFERENCES

  • 1.Sallenave J-M, Shulmann J, Crossley J, Jordana M, Gauldie J. Regulation of secretory leukocyte proteinase inhibitor (SLPI) and elastase-specific inhibitor (ESI/Elafin) in human airway epithelial cells by cytokines and neutrophilic enzymes. Am J Respir Cell Mol Biol. 1994;11:733–41. doi: 10.1165/ajrcmb.11.6.7946401. [DOI] [PubMed] [Google Scholar]
  • 2.Thompson RC, Ohlsson K. Isolation, properties, and complete amino acid sequence of human secretory leukocyte protease inhibitor, a potent inhibitor of leukocyte elastase. Proc Natl Acad Sci USA. 1986;83:6692–6. doi: 10.1073/pnas.83.18.6692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Smith CE, Johnson A. Human bronchial leukocyte protease inhibitor. Biochem J. 1985;225:463–72. doi: 10.1042/bj2250463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Seemuller U, Arnhold M, Fritz H, et al. The acid-stable proteinase inhibitor of human mucous secretions (HUSI-1, antileukoprotease). Complete amino acid sequence as revealed by protein and cDNA sequencing and structural homology to whey proteins and Red Sea turtle proteinase inhibitor. FEBS Letters. 1986;199:43–48. doi: 10.1016/0014-5793(86)81220-0. [DOI] [PubMed] [Google Scholar]
  • 5.Zhang Y, DeWitt DL, McNeely TB, Wahl SM, Wahl LM. Secretory leukocyte protease inhibitor suppresses the production of monocyte prostaglandin H synthase-2, prostaglandin E2, and matrix metalloproteinases. J Clin Invest. 1997;99:894–900. doi: 10.1172/JCI119254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bogdan C, Vodovotz Y, Nathan C. Macrophage deactivation by interleukin 10. J Exp Med. 1991;174:1549–55. doi: 10.1084/jem.174.6.1549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.De Waal Malefyt R, Yssel H, Roncarolo M-G, Spits H, de Vries JE. Interleukin-10. Curr Opin Immunol. 1992;4:314–20. doi: 10.1016/0952-7915(92)90082-p. [DOI] [PubMed] [Google Scholar]
  • 8.Murray PJ, Wang L, Onufryk C, Tepper RI, Young RA. T cell-derived IL-10 antagonizes macrophage function in mycobacterial infection. J Immunol. 1997;158:315–21. [PubMed] [Google Scholar]
  • 9.Sano C, Shimizu T, Sato K, Kawauchi H, Kawahara S, Tomioka H. Therapeutic effects of benzoxazinorifamycin KRM-1648 administrated alone or in combination with a half-sized secretory leukocyte protease inhibitor or the nonsteroidal anti-inflammatory drug diclofenac sodium against Mycobacterium avium complex infection in mice. Antimicrob Agents Chemother. 1999;43:360–4. doi: 10.1128/aac.43.2.360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ding A, Nathan CF, Graycar J, Derynck R, Stuehr DJ, Srimal S. Macrophage deactivating factor and transforming growth factors-β1, β2, and β3 inhibit induction of macrophage nitrogen oxide synthesis by IFN-γ. J Immunol. 1990;145:940–4. [PubMed] [Google Scholar]
  • 11.Wahl SM. Transforming growth factor beta (TGF-β) in inflammation: a cause and a cure. J Clin Immunol. 1992;12:61–74. doi: 10.1007/BF00918135. [DOI] [PubMed] [Google Scholar]
  • 12.Warwick-Davies J, Lowrie DB, Cole PJ. Selective deactivation of human monocyte functions by TGF-β. J Immunol. 1995;155:3186–93. [PubMed] [Google Scholar]
  • 13.Masuda K, Imaizumi A, Kamimura T, et al. Expression of the C-terminal domain of secretory leukoprotease inhibitor in E. coli as a thrombin-cleavable fusion protein. Am Rev Respir Dis. 1992;145:A200. doi: 10.1093/protein/9.1.101. [DOI] [PubMed] [Google Scholar]
  • 14.Renesto P, Balloy V, Kamimura T, Masuda K, Imaizumi A, Chignard M. Inhibition by recombinant SLPI and half-SLPI (Asn55-Ala107) of elastase and cathepsin G activities: consequence for neutrophil–platelet cooperation. Br J Pharmacol. 1993;108:1100–6. doi: 10.1111/j.1476-5381.1993.tb13511.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Masuda K, Kamimura T, Kanesaki M, et al. Efficient production of the C-terminal domain of secretory leukoprotease inhibitor as a thrombin- cleavable fusion protein in Escherichia coli. Prot Engineering. 1996;9:101–6. doi: 10.1093/protein/9.1.101. [DOI] [PubMed] [Google Scholar]
  • 16.Masuda K, Kamimura T, Watanabe K, et al. Pharmacological activity of the C-terminal and N-terminal domains of secretory leukoprotease inhibitor in vitro. Br J Pharmacol. 1995;115:883–8. doi: 10.1111/j.1476-5381.1995.tb15892.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Grutter MG, Fendrich G, Huber R, Bode W. The 2·5 A X-ray crystal structure of the acid-stable proteinase inhibitor from human mucous secretions analysed in its complex with bovine alpha-chymotrypsin. EMBO J. 1988;7:345–51. doi: 10.1002/j.1460-2075.1988.tb02819.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jin F, Nathan C, Radzioch D, Ding A. Secretory leukocyte protease inhibitor: a macrophage product induced by and antagonistic to bacterial lipopolysaccharide. Cell. 1997;88:417–26. doi: 10.1016/s0092-8674(00)81880-2. [DOI] [PubMed] [Google Scholar]
  • 19.Mitsuhashi H, Asano S, Nonaka T, Hamamura I, Masuda K, Kiyoki M. Administration of truncated secretory leukoprotease inhibitor ameliorates bleomycin-induced pulmonary fibrosis in hamsters. Am J Respir Crit Care Med. 1996;153:369–74. doi: 10.1164/ajrccm.153.1.8542145. [DOI] [PubMed] [Google Scholar]
  • 20.Tomioka H, Sato K, Shimizu T, et al. Effects of benzoxazinorifamycin KRM-1648 on cytokine production at sites of Mycobacterium avium complex infection induced in mice. Antimicrob Agents Chemother. 1997;41:357–62. doi: 10.1128/aac.41.2.357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Toossi Z, Young T-G, Averill LE, Hamilton BD, Shiratsuchi H, Ellner JJ. Induction of transforming growth factor β1 by purified protein derivative of Mycobacterium tuberculosis. Infect Immun. 1995;63:224–8. doi: 10.1128/iai.63.1.224-228.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhao X-M, First WH, Yeoh T-K, Miller GG. Modification of alternative messenger RNA splicing of fibroblast growth factor receptors in human cardiac allografts during rejection. J Clin Invest. 1994;94:992–1003. doi: 10.1172/JCI117466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Assoian RK, Fleurdely BE, Stevenson HC, et al. Expression and secretion of type β transforming growth factor by activated macrophages. Proc Natl Acad Sci USA. 1987;17:6020–4. doi: 10.1073/pnas.84.17.6020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Weinstein SL, June CH, DeFranco AL. Lipopolysaccharide-induced protein tyrosine phosphorylation in human macrophages is mediated by CD14. J Immunol. 1993;151:3829–38. [PubMed] [Google Scholar]
  • 25.Ingalls RR, Golenbock DT. CD11c/CD18, a transmembrane signaling receptor for lipopolysaccharide. J Exp Med. 1995;181:1473–9. doi: 10.1084/jem.181.4.1473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lei M-G, Stimpson SA, Morrison DC. Specific endotoxic lipopolysaccharide-receptor proteins on murine splenocytes. J Immunol. 1991;147:1925–32. [PubMed] [Google Scholar]
  • 27.Bermudez LE, Parker A, Goodman JR. Growth within macrophages increases the efficiency of Mycobacterium avium in invading other macrophages by a complement receptor-independent pathway. Infect Immun. 1997;65:1916–25. doi: 10.1128/iai.65.5.1916-1925.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ernst JD. Macrophage receptors for Mycobacterium tuberculosis. Infect Immun. 1998;66:1277–81. doi: 10.1128/iai.66.4.1277-1281.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kang BK, Schlesinger LS. Characterization of mannose receptor-dependent phagocytosis mediated by Mycobacterium tuberculosis lipoarabinomannan. Infect Immun. 1998;66:2769–77. doi: 10.1128/iai.66.6.2769-2777.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pilatte Y, Bignon J, Lambre CR. Lysosomal and cytosolic sialidases in rabbit alveolar macrophages: demonstration of increased lysosomal activity after in vivo activation with bacillus Calmette Guerin. Biochim Biophys Acta. 1987;923:150–5. doi: 10.1016/0304-4165(87)90138-3. [DOI] [PubMed] [Google Scholar]
  • 31.Silver IA, Murrills RJ, Etheriagton DJ. Microelectrode studies on the acid microenvironment beneath adherent macrophages and osteoblasts. Exp Cell Res. 1988;175:266–76. doi: 10.1016/0014-4827(88)90191-7. [DOI] [PubMed] [Google Scholar]
  • 32.Song X, Zeng L, Jin W, et al. Secretory leukocyte protease inhibitor suppresses the inflammation and joint damage of bacterial cell wall-induced arthritis. J Exp Med. 1999;190:535–42. doi: 10.1084/jem.190.4.535. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES