Abstract
Leucocyte adhesion deficiency type 1 (LAD-1) is characterized by the incapacity of leucocytes to carry out their adhesion functions via their CD11/CD18 antigens, which are also referred to as the leucocyte integrins. The patients generally suffer from poor wound healing and recurrent bacterial and fungal infections. In severe cases, the infections are often systemic and life-threatening. A LAD patient (AW) of moderate phenotype has been identified but, unlike most other cases, the level of CD11/CD18 antigens on her leucocytes are uncharacteristically high for a LAD patient. Molecular analysis revealed that she is a compound heterozygote for CD18 mutations. She has inherited a D231H mutation from her father and a G284S mutation from her mother. By transfection studies, it was established that the G284S mutation does not support CD11/CD18 antigen expression on the cell surface. In contrast, the D231H mutation does not affect CD18 forming integrin heterodimers with the CD11 antigens on the cell surface. However, the expressed integrins with the D231H mutation are not adhesive to ligands.
Keywords: leucocyte adhesion deficiency, CD11/CD18, integrin
INTRODUCTION
LAD is an autosomal recessive hereditary disorder caused by defects in the CD18 gene, which codes for the β2-integrin subunit [1,2]. Patients with LAD have diminished levels of expression of the three integrins LFA-1 (α Lβ2, CD11a/CD18), Mac-1 (α Mβ2, CD11b/CD18) and p150,95 antigen (α Xβ2, CD11c/CD18) on their leucocytes. The defect in adhesion activities mediated by the three leucocyte integrins is manifested in the characteristic clinical features of LAD patients, which include the elevation of neutrophil counts in the blood during infection, retarded wound healing, dystrophic scars from skin injuries, and susceptibility to recurrent bacterial and fungal infections. In most cases, the severity of the disorder appears to have a direct correlation with the level of residual expression of the CD11/CD18 antigens. Patients of the severe clinical phenotype would have, essentially, undetectable expression levels of the CD11/CD18 antigens and are susceptible to life-threatening systemic infections. Patients categorized as having the moderate phenotype would have up to approx. 10% the normal level and can generally survive to adulthood with proper medical care.
The molecular nature of the defect is very heterogeneous [2,3]. They include base deletions leading to frameshift mutations (three cases), abnormal splicing defects (four cases), and point mutations leading to a defective initiation codon (one case), a nonsense mutation (one case), and single amino acid changes (10 cases). In addition, there are also four cases in which the mRNA was expressed at very low levels. Among all the mutations characterized at the molecular level, there is only one CD18 mutation, S138P, that permits CD11/CD18 expression but imparts no function [4]. In this study we report the novel CD18 mutation D231H which, like S138P, supports CD11/CD18 expression but not their adhesive functions.
MATERIALS AND METHODS
Monoclonal antibodies
MHM23 (anti-CD11/CD18) and MHM24 (anti-CD11a) [5] were gifts from Professor A. J. McMichael (Institute of Molecular Medicine, Oxford, UK), LPM19c (anti-CD11b) [6] and KB43 (anti-CD11c) from Dr K. Pulford (LRF Diagnostic Unit, Oxford, UK), KIM185 (anti-CD18, activating MoAb) [7] from Dr M. K. Robinson (Celltech Therapeutics, Slough, UK), AZN-L21 (anti-CD11a/CD18) [8] from Dr Y. van Kooyk (University Hospital Nijmegen, Nijmegen, The Netherlands), and MoAb 24 (activation reporter for CD11a/CD18) [9] from Dr N. Hogg (Imperial Cancer Research Fund, London, UK). ICAM-1/Fc, ICAM-2/Fc, and ICAM-3/Fc were prepared as previously described [10]. iC3b was a gift from Drs A. W. Dodds and R. B. Sim (The MRC Immunochemistry Unit, Oxford, UK).
Sequence analysis of the defective CD18 alleles of patient AW
PolyA RNA was prepared from Epstein–Barr virus (EBV)-transformed cells of patient AW using reagents in the Oligotex Direct mRNA Mini Kit (Qiagen Ltd, Crawley, UK). mRNA (1·85 μ g) was obtained from 1·5 × 107 cells. Single-strand cDNA was prepared from 250 ng of mRNA with Expand™ Reverse Transcriptase (Boehringer Mannheim, Lewes, UK) in a total of 40 μ l. CD18-specific cDNA was amplified by nested polymerase chain reaction (PCR). Five microlitres of the cDNA were first amplified using the reagents in the Expand™ High Fidelity PCR System (Boehringer Mannheim) in 100 μ l for 25 cycles with the oligonucleotides K88/16 and A87/20 [11] as primers. The first round product (5 μ l) was amplified using the Pfu DNA polymerase (Stratagene, Amsterdam, The Netherlands) in 100 μ l for 12 cycles with the oligonucleotides K87/19 and F89/11 [11] as primers. The final product was digested with Xba I and the major band, after purification in an agrose gel (Qiagen), was cloned into the Hinc II and Xba I sites of pBluescript (Stratagene). DNA sequencing was performed using reagents in the T7Sequencing Kit (Pharmacia Biotech, St Albans, UK) on double-strand templates with the appropriate primers.
Genomic DNA was prepared from the EBV-transformed cell line of AW according to Bell et al. [12]. Genomic DNA from the parents of AW was prepared from peripheral blood leucocytes using PureGene Kit (Gentra Systems Inc., Minneapolis, MN). Genomic fragments containing exon 6 of CD18 were amplified by nested PCR using the primer pair I56F and I67R followed by the pair I56F2 and A89/15. Similarly, the region covering exon 7 was amplified using the primer pair I67F and I78R (reported as I67 and I78, respectively, in [4]) followed by the pair E94/04 and E94/03 [4]. The final products were purified using the StrataPrep PCR Purification Kit (Stratagene) before being subjected to restriction enzyme digestion. The products were analysed by electrophoresis on a 3% NuSieve GTG agarose gel (Flowgen, Lichfield, UK). The restriction enzymes Bst NI and Eag I were purchased from New England BioLabs (Hitchin, UK).
The sequences of the oligonucleotide primers not reported previously are: I56F, CTTGCACAACGCACATGCTC; I67R, CGTGGGGACCCAAGCAGG; I56F2, GCTAGGAGAGAGGAAACAGG; and A89/15, GGCAGGCGGCGACCTGC.
Analyses of COS-7 transfectants
CD11 (5 μ g) and 4 μ g of CD18 cDNA, cloned in respective pcDNA3 expression vectors (Invitrogen BV, Leek, The Netherlands), were transfected into COS-7 cells by the DEAE-dextran method [10]. Expression of the CD11/CD18 antigens was detected by flow cytometry using a FACScan cytometer (Becton Dickinson, Oxford, UK). Adhesion assays were carried out as described [13] except that the cells were labelled with 3·0 mm of 2′,7′-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein, acetoxymethyl ester (BCECF, AM) fluorescent dye (Molecular Probe, Leiden, The Netherlands) and the adherent cells were quantified using a Cytofluor 4000 microplate reader (PE Biosystems, Warrington, UK).
Expression of the activation reporter epitope of MoAb 24 on LFA-1 transfectants was monitored by flow cytometry. The cells were stained with MoAb 24, at 20 μ g/ml, in RPMI media (RPMI 1640 supplemented with 5%fetal bovine serum and 10 mm HEPES, pH 7·5), or in HEPES bovine serum albumin (BSA) buffer (10 mm HEPES, 150 mm NaCl, 0·1% BSA) with 5 mm MgCl2 and 1·5 mm EGTA (Mg/EGTA) at 37°C for 30 min. The cells were washed twice in the same buffer before staining with the FITC-conjugated second antibody in RPMI media.
RESULTS
Patient AW
The patient is a Caucasian girl of North European background born in April 1995 in the USA. Her umbilical cord separated within the normal time window. She has severe periodontal disease and a long history of skin rashes. She is slow in healing from insect bites, and exhibits dystrophic scarring. Her leucocyte count, in two separate determinations when the patient was ill, was 31 000 and 30 000 per mm3, with 64% and 80% neutrophils, respectively. When the patient is well, her leucocyte count is typically between 7000 and 12 000 per mm3 with > 60% neutrophils. CD11/CD18 expression on her neutrophils was found to be abnormal, but is atypical of previously characterized LAD patients: she has reduced levels of CD18 (37%) and CD11b (20%) expression, a slightly reduced level of CD11a (65%) and an elevated level of CD11c (140%) expression. On one occasion, her CD11b level was found to drop below 10% of normal. Thus, it was suspected that she has a variant form of LAD involving the expression of dysfunctional CD11/CD18 antigens.
Molecular characterization of CD18 defects
In the absence of any indication that AW's defect lies in the CD11 or other molecules, we decided to begin with the analysis of her CD18 genes. cDNA clones obtained from the EBV-transformed cells of AW were sequenced. Two types of clones were found: one carrying the novel mutation D231H and the other G284S which had been reported previously [11,14]. Two clones of each type were sequenced to cover the entire coding sequence of CD18. Clones with the D231H mutation also contain the polymorphism for G273 and V367. Additional cDNA clones were sequenced across the two mutation points. From a total of eight clones three carry the D231H mutation and five the G284S mutation. In addition, the D231H mutation leads to the loss of a Bst NI restriction enzyme site and the G284S to the loss of an Eag I site. Details of the mutant alleles are shown in Table 1.
Table 1.
Mutations and polymorphisms in the CD18 alleles of patient AW*
| Nucleotide change‡ | |||||||
|---|---|---|---|---|---|---|---|
| Mutations/ | Location | Enzyme site | No. of clones | Exon | |||
| Alleles | polymorphisms† | Normal | Variant | in cDNA§ | change | variant/total | location¶ |
| 1 | D231H | CCTG(GAT) | CCTG(CAT) | 691 | Bst NI loss | 3/8 | 6 |
| G273** | (GGG) | (GGA) | 819 | 7 | |||
| V367 | (GTC) | (GTA) | 1101 | 10 | |||
| 2 | G284S | C(GGC)CG | C(AGC)CG | 850 | Eag I loss | 5/8 | 7 |
mRNA was obtained from the Epstein–Barr virus (EBV)-transformed cell line of AW. CD18-specific cDNA was prepared by reverse transcriptase-polymerase chain reaction. A total of eight clones was analysed by sequencing. Three of the clones were found to contain the mutation D231H and the other five the mutation G284S. The clones with the D231H mutation were also found to contain the polymorphic codons for the residues G273 and V367.
Mutations and polymorphisms in the CD18 sequence. The initiation methionine is assigned number ‘1’ in the protein sequence. The mutations are shown in bold.
The changed nucleotides are shown in bold. The affected codons are in parentheses. Relevant restriction enzymes sites are underlined. For clarity, the DNA sequences and numbering are shown in italics.
The ‘A’ in the initiation codon ‘ATG’ for methionine is assigned number ‘1’.
Exon locations are assigned according to Weitzman et al. [15].
The two mutations are located in different exons of the CD18 gene [15]: D231H in exon 6 and G284S in exon 7. Genomic DNA was prepared from the EBV-transformed cells of AW and genomic DNA from the parents was prepared from their respective peripheral blood leucocytes. Fragments spanning the two mutations were amplified with nested PCR. Since both mutations result in the loss of restriction enzyme sites, the fragments were analysed by digestion with either Bst NI or Eag I.
Nested PCR yielded a 342-bp fragment covering the D231H mutation in exon 6. There are two Bst NI sites in this fragment and the D231H mutation is associated with the loss of the second Bst NI site. Digestion of the fragment from a normal individual (Fig. 1a, SL) gave three fragments of 235, 58 and 51 bp as predicted. DNA from AW's mother (TW) gave the same profile. In contrast, digestion of the PCR fragments of AW and her father (MW) yielded four bands of 285, 235, 58 and 51 bp. These profiles are consistent with one wild-type allele being digested to completion to give the 235, 58 and 51-bp bands, and one D231H allele cut only at the first Bst NI site to give the 285- and 58-bp bands. The results (Fig. 1a) are consistent with AW and her father being heterozygous with respect to the D231H mutation.
Fig. 1.
Restriction site analyses of exons 6 and 7 of the CD18 genes of AW (LAD patient) and her parents MW (father) and TW (mother). (a) The 342-bp fragments spanning exon 6 were either left undigested (U) or digested with Bst NI (B) and the samples were run in a 3% Nusieve agarose gel. (b) The 175-bp fragments spanning exon 7 were similarly analysed with the restriction enzyme Eag I (lanes marked E). SL is a normal unrelated individual, and BB and YM are LAD patients who are homozygous for the G284S mutation.
There is only one Eag I site in exon 7 and it is abrogated by the G284S mutation. Digestion of the 175-bp PCR fragment from a normal individual (SL) with Eag I yielded two bands of 97 and 79 bp (Fig. 1b). The same profile was obtained from the DNA fragment of AW's father (MW). The DNA fragments from two patients (BB and YM), known to be homozygous for the G284S mutation, were resistant to Eag I digestion. However, digestion of the PCR fragments derived from AW and her mother (TW) gave three bands of 175, 97 and 79 bp. This profile is consistent with both AW and TW carrying one normal allele, digested to yield the 97- and 79-bp fragments, and one G284S mutant allele, which is resistant to Eag I. Thus AW and her mother are heterozygous with respect to the G284S mutation.
Genomic fragments of CD18 exon 6 from MW were cloned and sequenced, and three out of four clones carried the CAT codon for the mutant histidine residue (see Table 1). Similarly, two out of five clones encoding CD18 exon 7 from TW carried the AGC codon for the mutant serine residue. Taking all data together, AW is a compound heterozygote of LAD who has inherited the D231H mutation from her father and the G284S mutation from her mother.
Functional studies
The EBV-transformed cells of AW were assayed for the surface expression of LFA-1 by flow cytometry. For comparison, the EBV-transformed cell lines from a normal individual, Fel-2, and the LAD patient YM who was homozygous for the G284S mutation (S. K. A. Law, unpublished work) were included (Fig. 2). Whereas LFA-1 was expressed on the cells derived from AW and Fel-2, it was not detected on the cells from YM. Hence, the LFA-1 expression on the EBV-transformed cells from AW carries the D231H mutation in the CD18 subunit.
Fig. 2.
Expression of LFA-1 (CD11a/CD18) on Epstein–Barr virus (EBV)-transformed cells from (a) a normal individual Fel-2; (b) AW with the D231H and G284S mutations in her CD18 alleles; and (c) YM who is homozygous for the G284S mutation. Cells were stained with the LFA-1-specific MoAb MHM24 (bold) and background profiles (shaded) were obtained with the MoAb KB43.
Transfection studies in COS-7 cells confirmed that the CD18 subunit with the D231H mutation can support CD11a/CD18 expression. The D231H and G284S mutations were introduced, separately, into a wild-type CD18 cDNA clone. The wild-type or variant CD18 cDNAs were transfected into COS-7 cells together with the CD11a cDNA. Similar levels of CD11a/CD18 expression were detected on the transfectants with the wild-type CD18 and CD18 with the D231H mutation, but not on transfectants with the G284S mutation in the CD18 subunit (Fig. 3). Similar results were obtained for the expression of the CD11b/CD18 and CD11c/CD18 antigens, although the levels of expression were lower for CD18 carrying the D231H mutation. The CD11/CD18 transfectants with the D231H mutation were tested for their adhesion to various ligands. COS-7 transfectants expressing wild-type CD11a/CD18 required the presence of Mg/EGTA for adhesion to ICAM-1 [18], and the activating MoAb KIM185 in addition to Mg/EGTA for adhesion to ICAM-2 and ICAM-3 (Fig. 4) [18]. Transfectants expressing CD11b/CD18 or CD11c/CD18 also required KIM185 for adhesion to either denatured BSA or iC3b. In contrast, transfectants expressing the CD11/CD18 integrins with the D231H mutation were not adherent to any of the ligands under identical conditions (Fig. 5).
Fig. 3.
Expression of CD11/CD18 antigens on COS-7 transfectants. Wild-type and mutant CD18 cDNA were cotransfected into COS-7 cells with either CD11a, CD11b or CD11c cDNA. Expression of the CD11/CD18 antigens was monitored by flow cytometry. The MoAb AZN-L21 was used to detect CD11a/CD18 heterodimer expression, whereas MHM23 was used to detect CD11b/CD18 and CD11c/CD18 heterodimer expression (solid lines). Background histograms (shaded) were obtained with the same antibodies on COS-7 cells transfected with the CD11 antigens alone. Specific expression is obtained by subtractive histogram analysis using the CellQuest software (Becton Dickinson) (shown in bold) from which percentage gated positive cells (%GP) and mean fluorescent intensity (MFI) of the positive population were also obtained. The expression index (EI) is calculated as 100 × (% positive cells) × MFI.
Fig. 4.
Adhesion of COS-7 transfectants expressing wild-type LFA-1 (CD11a/CD18) (upper panels) or LFA-1 with the D231H mutation (lower panels) to ICAM-1, ICAM-2 and ICAM-3. Experiments were performed in RPMI media without activating reagents (□), in the presence of 5 mm MgCl2 and 1·5 mm EGTA (Mg/EGTA) (hatched), and in Mg/EGTA with the activating MoAb KIM185 at 2·5 μ g/ml (▪). The CD11a-specific MoAb MHM24, at 10 μ g/ml, was used to block adhesion (shown as forward bars).
Fig. 5.
Adhesion of Mac-1 (CD11b/CD18) (left panels) and p150,95 (CD11c/CD18) (right panels) transfectants to iC3b and denatured bovine serum albumin (BSA). Experiments were performed in RPMI media in the absence (□), and presence (hatched bars), of the activating MoAb KIM185 at 2·5 μ g/ml. Adhesion was blocked with CD11b-specific MoAb LPM19c or CD11c-specific MoAb KB43, both at 10 μ g/ml (shown as forward bars). Results from the wild-type transfectants are shown in the upper panels, and those with the D231H mutation in the lower panels.
Adhesion of CD11a/CD18 to ICAM-1 is associated with the expression of the reporter epitope of MoAb 24 [9]. Thus, whereas CD11a/CD18 transfectants do not express MoAb 24 in RPMI media, expression of the epitope can be induced with Mg/EGTA (Fig. 6), along with their capacity to adhere to ICAM-1 (Fig. 4). In contrast, the epitope of MoAb 24 is detected at a very low level on transfectants expressing the CD11a/CD18 with the D231H mutation even in the presence of Mg/EGTA (Fig. 6). The expression of the MoAb 24 epitope can also be induced with MnCl2 on wild-type LFA-1, but not on LFA-1 with the D231H mutation (data not shown).
Fig. 6.
Expression of the MoAb 24 epitope on LFA-1. COS-7 transfectants expressing wild-type LFA-1 (upper panels) and LFA-1 with the D231H mutation (lower panels) were stained with MoAb 24 in RPMI media or in a HEPES/bovine serum albumin (BSA) buffer with Mg/EGTA at 37°C. Specific expression was shown by subtractive histograms (bold lines). Surface expression of LFA-1 was monitored with the MoAb MHM23 (left panels). Expression indices (EI) were obtained from %GP and mean fluorescence intensity (MFI) as in Fig. 3.
DISCUSSION
AW has the clinical symptoms characteristic of patients with LAD, but the associated leucocyte CD11/CD18 expression levels are distinct from previously described LAD cases. Molecular analysis revealed that AW is a compound heterozygote for CD18 defects, and has a D231H mutation in one allele inherited from her father and a G284S mutation in the other allele inherited from her mother. Functional analyses of the two mutations showed that whereas CD18 with the G284S mutation fails to support CD11/CD18 expression, CD18 with the D231H mutation can support the expression of all three CD11/CD18 integrins: LFA-1 (CD11a/CD18), Mac-1 (CD11b/CD18) and p150,95 (CD11c/CD18). However, these integrins lack any detectable adhesion activities on the ligands tested. In the case of the LFA-1, we have also shown the D231H mutant form cannot be induced with Mg/EGTA to express the activation reporter epitope of MoAb 24. In addition, it should be noted that CD18 with the D231H mutation is less effective in supporting Mac-1 and p150,95 expression. It is possible that the D231H mutation has a subtle effect on the conformation of CD18 which affects its ability to associate with the CD11b and CD11c subunits but not the CD11a subunit.
The aspartic acid residue at position 231 (D231) of CD18 has been shown to be important in the adhesion of CD11/CD18 antigens. A D231A mutant (reported as D232A in [19]) has been constructed and was found to support both LFA-1 and Mac-1 expression, but the LFA-1(D231A) was incapable of mediating adhesion to ICAM-1, and similarly, the Mac-1(D231A) was defective in adhesion to iC3b, fibrinogen and ICAM-1 [19]. Results presented here regarding the D231H mutation are in general agreement with the observations on the D231A mutants. In addition, LFA-1(D231H) was shown to be defective in adhesion to ICAM-2 and ICAM-3, and Mac-1(D231H) was unable to bind to denatured BSA. Furthermore, we have shown that D231H can also support p150,95 expression, and that the p150,95(D231H) is defective in adhesion to iC3b and denatured BSA.
We have previously demonstrated that the CD18 containing the G284S mutation does not support LFA-1 and Mac-1 expression [11] and we have now extended this characterization to include p150,95. The glycine residue at position 284 lies in the sequence TPNDG284RC. When the glycine is converted to a serine, a potential N-linked glycosylation site is created. Whether the defect in LAD is due to the mutation of the glycine or the creation of the extra N-linked glycosylation site will be subject to future investigations. G284S is the most common single amino acid substitution found among LAD patients. To date, there have been three cases of LAD homozygous for G284S, including patient B reported in [11], and the two patients BB and YM shown in Fig. 1(D. C. Anderson and S. K. A. Law, unpublished work). Three cases of compound heterozygotes with the G284S have been described: AW reported here (D231H/G284S), patient R (G284S/R593C) [11], and another patient whose other CD18 allele was not expressed at the RNA level [14]. These six patients are not known to be related to each other.
AW has a consistently depressed level of CD11b/CD18 and an elevated level of CD11c/CD18 on her neutrophils when compared with neutrophils of normal individuals, which raises the question of whether one or both of AW's CD11b genes was also defective. However, CD11 defects have never been reported and therefore seem unlikely to be the cause of LAD in AW, especially with the knowledge that AW has inherited the CD18 mutated alleles from her parents. Differences in CD11/CD18 expression in LAD patients due to the different homeostasis of their neutrophils have never been addressed before because, for the majority of previously identified LAD cases, the levels of CD11/CD18 expression were too low. In the one other case of LAD in which CD11/CD18 expression was notable [4], the relative levels of CD11/CD18 expression on the patient (JT)'s neutrophils were comparable to those of AW. The CD11b/CD18 level of JT was also depressed (approx. 25%) in comparison with his CD11a/CD18 level (approx. 75%) (see Fig. 1a in reference), whilst his CD11c/CD18 level was elevated to approx. 135% that of normal (N. Klein, personal communication). Hence, the pattern of expression exhibited by JT and AW may be characteristic of LAD neutrophils with expressed but non-functional CD11/CD18 antigens. Taking these points into consideration, it is most likely that AW's LAD is caused solely by her CD18 mutations.
Since all adhesion assays performed with the D231H mutant CD11/CD18 antigens gave negative results, it is not possible to account for the moderate LAD phenotype of patient AW. However, it must be emphasized that these experiments are by no means exhaustive, especially when novel ligands and functions of CD11/CD18 antigens are continuously being identified. CD11a/CD18 is also known to bind the Landsteiner–Wiener antigen [20] and telencephalin [21], but the functional significance of these interactions is not clear [22]. In addition to binding to a well characterized array of ligands such as iC3b [23], fibrinogen [24], factor X [25], ICAM-1 [26], and denatured peptides [27] in a divalent cation-dependent fashion, CD11b/CD18 also binds β-glucan in a cation-independent manner [28]. It has been proposed, from the study of CD11b-deficient mice, that CD11b/CD18 is involved in the programmed cell death of neutrophils, but the mechanism is not known [29]. CD11c/CD18 binds most ligands of CD11b/CD18 [30], but a CD11c/CD18-specific ligand has yet to be identified. We have not performed any experiments with CD11d. Previously, it was not necessary to consider this wide range of CD11/CD18-mediated functions in the analyses of LAD mutations since they lead to poor expression of CD11/CD18. In our two LAD cases, where CD11/CD18 expression is not significantly affected, it will require extensive investigation to assess the impact of the S138P [4] and D231H mutations on the functions of the CD11/CD18 antigens.
Acknowledgments
We would like to thank the family of AW for their co-operation with this study. This work is supported in part by grants from the Arthritis Research Campaign, UK (L0509), and from the Sir Samuel Scott of Yews Trust, UK. We also thank R. H. Hyland for critical reading of the manuscript.
References
- 1.Arnaout MA. Leukocyte adhesion molecules deficiency: its structural basis pathophysiology and implications for modulating the inflammatory response. Immunol Rev. 1990;114:145–80. doi: 10.1111/j.1600-065x.1990.tb00564.x. [DOI] [PubMed] [Google Scholar]
- 2.Anderson DC, Kishimoto TK, Smith CW. Leukocyte adhesion deficiency and other disorders of leukocyte adherence and motility. In: Shriver CR, Beaudet AL, Sly WS, Valle D, editors. The metabolic basis of inherited diseases. 7. New York: McGraw-Hill Inc; 1994. pp. 3955–94. [Google Scholar]
- 3.Kishimoto TK, Hollander N, Roberts TM, Anderson DC, Springer TA. Heterogeneous mutations in the β subunit common to the LFA-1, Mac-1, and p150,95 glycoproteins cause leukocyte adhesion deficiency. Cell. 1987;50:193–202. doi: 10.1016/0092-8674(87)90215-7. [DOI] [PubMed] [Google Scholar]
- 4.Hogg N, Stewart MP, Scarth SL, Newton R, Shaw JM, Law SKA, Klein N. A novel leukocyte adhesion deficiency caused by expressed but nonfunctional β2 integrins Mac-1 and LFA-1. J Clin Invest. 1999;103:97–106. doi: 10.1172/JCI3312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hildreth JEK, Gotch FM, Hildreth PDK, McMichael AJ. A human lymphocyte-associated antigen involved in cell mediated lympholysis. Eur J Immunol. 1983;12:202–8. doi: 10.1002/eji.1830130305. [DOI] [PubMed] [Google Scholar]
- 6.Uciechowski P, Schmidt RE. Cluster report: CD11. In: Knapp W, Dörken B, Gilks WR, Rieber EP, Schmidt RE, von Stein H, dem Borne AEGKr, editors. Leucocyte typing IV White cell differentiation antigens. Oxford: Oxford University Press; 1989. pp. 543–51. [Google Scholar]
- 7.Andrew D, Shock A, Ortlepp S, Bell J, Robinson MK. KIM185, a monoclonal antibody to CD18 which induces a change in conformation of CD18 and promotes both LFA-1 and CR3-dependent adhesion. Eur J Immunol. 1993;23:2217–22. doi: 10.1002/eji.1830230925. [DOI] [PubMed] [Google Scholar]
- 8.Hogg N. CD11a workshop panel report. In: Kishimoto T, von Kikutani H, dem Borne A, et al., editors. Leucocyte typing VI White cell differentiation antigens. New York: Garland; 1997. pp. 355–7. [Google Scholar]
- 9.Dransfield I, Cabañas C, Craig A, Hogg N. Divalent cation regulation of the function of the leukocyte integrin LFA-1. J Cell Biol. 1992;116:219–26. doi: 10.1083/jcb.116.1.219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Simmons DL. Cloning cell surface molecules by transient expression in mammalian cells. In: Hartley D, editor. Cellular interactions in development. Oxford: Oxford University Press; 1993. pp. 93–128. [Google Scholar]
- 11.Wright AH, Douglass WA, Taylor GM, Lau YL, Higgins D, Davies KA, Law SKA. Molecular characterization of leukocyte adhesion deficiency in six patients. Eur J Immunol. 1995;25:717–22. doi: 10.1002/eji.1830250313. [DOI] [PubMed] [Google Scholar]
- 12.Bell GI, Karam JH, Rutter WJ. Polymorphic DNA region adjacent to the 5′ end of the human insulin gene. Proc Natl Acad Sci USA. 1981;78:5759–63. doi: 10.1073/pnas.78.9.5759. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Al-Shamkhani A, Law SKA. Expression of the H52 epitope on the β2 subunit is dependent on its interaction with the α subunits of the leukocyte integrins LFA-1, Mac-1 and p150,95 and the presence of Ca2+ Eur J Immunol. 1998;28:3291–300. doi: 10.1002/(SICI)1521-4141(199810)28:10<3291::AID-IMMU3291>3.0.CO;2-E. [DOI] [PubMed] [Google Scholar]
- 14.Back AL, Kerkering M, Baker D, Bauer TR, Embree LJ, Hickstein DD. A point mutation associated with leukocyte adhesion deficiency type 1 of moderate severity. Biochem Biophys Res Commun. 1993;193:912–8. doi: 10.1006/bbrc.1993.1712. [DOI] [PubMed] [Google Scholar]
- 15.Weitzman JB, Wells CE, Wright AH, Clark PA, Law SKA. The gene organisation of the human β2 integrin subunit (CD18) FEBS Letters. 1991;294:97–103. doi: 10.1016/0014-5793(91)81351-8. [DOI] [PubMed] [Google Scholar]
- 16.Kishimoto TK, O'connor K, Lee A, Roberts TM, Springer TA. Cloning of the β subunit of the leukocyte adhesion proteins: homology to an extracellular matrix receptor defines a novel supergene family. Cell. 1987;48:681–90. doi: 10.1016/0092-8674(87)90246-7. [DOI] [PubMed] [Google Scholar]
- 17.Law SKA, Gagnon J, Hildreth JEK, Wells CE, Willis AC, Wong AJ. The primary structure of the β-subunit of the cell surface adhesion glycoproteins LFA-1, CR3 and p150,95 and its relationship to the fibronectin receptor. EMBO J. 1987;6:915–9. doi: 10.1002/j.1460-2075.1987.tb04838.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Douglass WA, Hyland RH, Buckley CD, Al-Shamkhani A, Shaw JM, Scarth SL, Simmons DL, Law SKA. The role of the cysteine-rich region of the β2 integrin subunit in the leukocyte function-associated antigen-1 (LFA-1, αLβ2, CD11a/CD18) heterodimer formation and ligand binding. FEBS Letters. 1998;440:414–8. doi: 10.1016/s0014-5793(98)01498-7. [DOI] [PubMed] [Google Scholar]
- 19.Goodman TG, Bajt ML. Identifying the putative metal ion-dependent adhesion site in the β2 (CD18) subunit required for αLβ2 and αMβ2 ligand interactions. J Biol Chem. 1996;271:23729–36. doi: 10.1074/jbc.271.39.23729. [DOI] [PubMed] [Google Scholar]
- 20.Bailly P, Tontti E, Hermand P, Cartron JP, Gahmberg CG. The red cell LW blood group protein is an intercellular adhesion molecule which binds to CD11/CD18 leukocyte integrins. Eur J Immunol. 1995;25:3316–20. doi: 10.1002/eji.1830251217. [DOI] [PubMed] [Google Scholar]
- 21.Tian L, Yoshihara Y, Mizuno T, Mori K, Gahmberg CG. The neuronal glycoprotein telenchephalin is a cellular ligand for the CD11a/CD18 leukocyte integrin. J Immunol. 1997;158:928–36. [PubMed] [Google Scholar]
- 22.Gahmberg CG. Leukocyte adhesion: CD11/CD18 integrins and intercellular adhesion molecules. Current Opin Cell Biol. 1997;9:643–50. doi: 10.1016/s0955-0674(97)80117-2. [DOI] [PubMed] [Google Scholar]
- 23.Beller DI, Springer TA, Schreiber RD. Anti-Mac-1 selectively inhibits the mouse and human type three complement receptor. J Exp Med. 1982;156:1000–9. doi: 10.1084/jem.156.4.1000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wright SD, Weitz JI, Huang AJ, Levin SM, Silverstein SC, Loike JD. Complement receptor type three (CD11b/CD18) of human polymorphonuclear leukocyte recognizes fibrinogen. Proc Natl Acad Sci USA. 1988;85:7734–8. doi: 10.1073/pnas.85.20.7734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Altieri DC, Edgington TS. The saturable high affinity association of factor X to ADP-stimulated monocytes defines a novel function of Mac-1 receptor. J Biol Chem. 1988;263:7007–15. [PubMed] [Google Scholar]
- 26.Diamond MS, Staunton DE, de Fougerolles AR, Stacker SA, Garcia-Aguilar J, Hibbs ML, Springer TA. ICAM-1 (CD54): a counter-receptor for Mac-1 (CD11b/CD18) J Cell Biol. 1990;111:3129–39. doi: 10.1083/jcb.111.6.3129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Davis GE. The Mac-1 and p150,95 β2 integrins bind denatured proteins to mediate leukocyte cell-substrate adhesion. Exp Cell Res. 1992;200:242–52. doi: 10.1016/0014-4827(92)90170-d. [DOI] [PubMed] [Google Scholar]
- 28.Thornton BP, Vetvicka V, Pitman M, Goldman RC, Ross GD. Analysis of the sugar specificity and molecular location of the β-glucan-binding lectin site of complement receptor type 3 (CD11b/CD18) J Immunol. 1996;156:1235–46. [PubMed] [Google Scholar]
- 29.Coxon A, Rieu P, Barkalow FJ, Askari S, Sharpe AH, von Andrian UH, Arnaout MA, Mayadas TN. A novel role for the β2 integrin CD11b/CD18 in neutrophil apoptosis: a homeostatic mechanism in inflammation. Immunity. 1996;5:653–66. doi: 10.1016/s1074-7613(00)80278-2. [DOI] [PubMed] [Google Scholar]
- 30.Law A, Morley BJ, Walport MJ. The complement factsbook. London: Academic Press; 2000. pp. 198–203. [Google Scholar]