TABLE 3.
Neisserial genes with putative Fur boxesa
| Gene | Function | Comparison with neisserial consensus (GATAATATAATAA-TTATCTTT)b | No. of nucleotides identical | Binding of Gc/Ec Furc |
|---|---|---|---|---|
| tonB | Energy transducer | ACAACAAATTATAAAAAATAGG | 13 | Yes/Yes |
| opa | Intergonococcal adherence | TTCAACATCAGTGAAAATCTTT | 13 | Yes/Nod |
| fur | Global regulator | GATAATCATACGCTTAAGCGC | 12 | Yes/Yes |
| sod | Superoxide dismutase | TATAATAGAAGATTGCAATTT | 13 | Yes/Yes |
| hemO | Heme oxygenase | AAAAATATCATTTGCGTTATATTT | 15 | Yes/Yes |
| hmbR | Hemoglobin receptor | GTTAATTCATAATAAATTTTCTGA | 17 | Yes/Yes |
| secY | Preprotein translocase | GAGATCTTAAGAAACGTCTTT | 13 | Yes/Yes |
| recN | Recombination protein | AAAAATCTTAGTTATAATTCGTAT | 14 | Yes/Yes |
| fumC | Fumarate hydratase | GCGAATCACTCTTATTCACATTT | 13 | Yes/Yes |
| Hypothetical gene | TGTAATGATAATTATTATCGAA | 15 | Yes/Yes |
a
Partial listing of Neisseria genes containing putative Fur binding sequence (Fur box) in the promoter/operator. Consensus homology was determined by comparison with the previously published 21-bp gonococcal Fur box consensus (9).
b
Identical nucleotides are in boldface type.
c
Binding of gonococcal (Gc) and E. coli (Ec) Fur proteins to the promoter regions of these genes was determined by EMSA with 500 ng of Fur protein.
d
opaH, opaI, and opaE do bind to E. coli Fur.