Structure-activity relationships of steroid and sterol neuromodulators on inflammatory markers in a murine microglial cell line

2.1. Reagents

Lipopolysaccharide (LPS) from Escherichia coli O111:B4 (L2630, Lot 028M4021V) and dexamethasone (DEX) (D4902) were purchased from Millipore Sigma (St. Louis, MO). Neuroactive steroids, AlloP and its enantiomer (ent-AlloP), progesterone and ent-progesterone, etiocholanolone (Etio) and ent-Etio, and KK-129 were prepared by the Covey laboratory. 3β5αP, pregnenolone sulfate (PS) and 25-hydroxycholesterol (25-HC) were purchased from Millipore Sigma. Oxysterol variants of 24S-hydroxycholesterol (24S-HC), SGE-201 and SGE-301were synthesized by previously published methods [26] and were gifts from Sage Therapeutics (Boston, MA).

2.2. Cell culture of BV2 cells and treatment

The BV2 murine microglial-derived cell line was maintained at 37°C with 5% CO₂ in a humidified incubator. Cells were cultured with high-glucose DMEM medium (Gibco, Thermo-Fisher Scientific) supplemented with 10% fetal bovine serum and 1% penicillin streptomycin. Cells were plated in 12-well plates a day before experiments at a density of 3.75 × 10⁵/ml. At 70% confluence, LPS (100 ng/ml) was applied to each well for overnight treatment, with or without the neuroactive steroids co-applied. Controls utilized the DMSO vehicle. In addition to naïve cells, the neurosteroid analogues alone (without LPS) or DMSO alone were used as comparison conditions.

2.3. Total RNA extraction and cDNA synthesis in BV2 microglia cells

Total RNA was isolated from the cell lysates using the RNeasy Mini Kit (QIAGEN GmbH, Germany) in accordance with the manufacture’s protocols. RNA was quantified using a ND1000 nanodrop spectrophotometer. cDNA was synthesized from 1 μg of RNA using a SuperScript II Reverse Transcriptase (Invitrogen, Thermo-Fisher Scientific) using random primers.

2.4. Quantitative real-time polymerase chain reaction (qPCR)

The gene expression levels of IL-1β, IL-6 and TNF-α in BV2 cells were determined by real-time quantitative PCR (qPCR). cDNA was mixed with Master Mix Universal for SYBR Green (Lamda Biotech, St. Louis, MO) and primers specific to the genes of interest. Real-time qPCR amplification was performed on QuantStudio 3 (Applied Biosystems, Foster City, CA).

Primers: For IL-1β, the forward sequence was Fw: GGCAACTGTTCCTGAACTCAACTG and reverse was Rv: CCATTGAGGTGGAGAGCTTTCAGC. For IL-6, Fw: CCACTTCACAAGTCGGAGGCTT and Rv: CCAGCTTATCTGTTAGGAGA. For TNFα, Fw: CCTATGTCTCAGCCTCTTCT and Rv: CCTGGTATGAGATAGCAAAT. For IL-10, Fw: ATAACTGCACCCACTTCCCA and Rv: GGGCATCACTTCTACCAGGT. For GAPDH, Fw: AGGTCGGTGTGAACGGATTTG and Rv: TGTAGACCATGTAGTTGAGGTCA.

The threshold cycle (Ct) value was defined as the cycle number at which the fluorescence crossed a fixed threshold above the baseline. For relative quantification, fold changes were measured using the ΔΔCt method. For each sample, the Ct value of cytokine mRNA was compared with the GAPDH endogenous control as ΔCt (ΔCt = Ct_cytokine – Ct_GAPDH). The cytokine mRNA fold change in experimental sample relative to control samples was determined using 2^−ΔΔCt (ΔΔCt = ΔCt_experiment – Δct_control).

2.5. Solvent controls and compound concentration-response curve

Control conditions in main Figures correspond to DMSO solvent controls (0.1% maximum). There was no effect of DMSO on IL-6 transcription compared to the LPS alone group (1.04 ± 0.11, N = 8, Supplemental Figure 1 A).

AlloP and ent-AlloP were evaluated at a fuller range of concentrations than other compounds. BV2 cells were co-treated with compounds at concentrations of 0.03, 0.1, 0.3 and 1 μM during overnight LPS administration. Total RNA was isolated as described in Section 2.3 and assayed by qPCR as in Section 2.4.

2.6. Measurement of cytokine levels in BV2 culture medium

Cytokine protein levels in BV2 cell culture medium were determined by Luminex FLEXMAP 3D technology (Millipore Sigma, St. Louis). A predesigned MillPlex of 32 mouse cytokine was used. A group of culture medium samples was selected with their matched qPCR sample dataset. Cytokine concentrations were expressed as pg/ml in medium and subjected to further correlation analysis. The full original files of the MilliPlex results are uploaded to FigShare (https://doi.org/10.6084/m9.figshare.30053995.v1).

2.7. Cell viability assay

For cell viability assays, BV2 cells were seeded onto 12-well plates one day prior to the experiment. AlloP, ent-AlloP, Etio and ent-Etio, representing steroids with effects on cytokine expression, were administered with and without LPS at a concentration of 10 μM overnight. Cell viability was assessed using the Trypan Blue method (Sigma Life Science), following the manufacturer’s protocol. After incubation, cells were washed with PBS, resuspended, and incubated with dye. Cell counts were performed using a hemocytometer. The percentage of dead cells relative to the total cell population was calculated to determine cell viability. Representative brightfield images were acquired using a Nikon Eclipse microscope with a 20x objective.

2.8. Statistical analysis

Statistical analyses were performed using GraphPad Prism version 10.4.0 software. Power analyses were used on pilot datasets to generate target N values. Data are presented as the mean ± SEM. The differences in cytokine levels between LPS alone and compound-treated groups were tested by the Wilcoxon signed-rank test. Multiple corrections were not performed because experiments were performed largely independently of each other and are grouped in figures for ease of description only. Exact P values are displayed in figures. Sample sizes are indicated by data points on graphs. Comparisons between protein and RNA expression levels were compared by linear regression, detailed in the figure legend.

3.1. AlloP and ent-AlloP inhibit LPS-induced transcription of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α

The chemical structures of compounds selected for the present studies are illustrated in Fig. 1. These include natural neurosteroids, their unnatural enantiomers, oxysterols, and oxysterol analogues. We prioritized AlloP, since it is in clinical use and is also a canonical naturally occurring neurosteroid. A priority comparator was the unnatural enantiomer of AlloP (ent-AlloP), which exhibits weak GABA_A receptor activity [31]. Oxysterols are oxidative cholesterol metabolites with various signaling roles distinct from neurosteroids [24].

To investigate the potential effects of neuroactive steroids under neuroinflammatory conditions, we challenged microglial-derived BV2 cells with LPS administration to model cellular inflammation. LPS increased transcription of inflammatory cytokines relative to naïve cells (Fig. 2A-C, yellow bars). The prototypical neurosteroid AlloP, co-applied overnight with LPS, reduced the LPS-induced transcriptional changes of IL1-β by 48% compared to LPS alone at 1 μM. Tenfold higher concentration (10 μM) produced a similar effect (Fig. 2A red bars). The enantiomer of AlloP, ent-AlloP is only weakly effective at GABA_A receptors but exhibited a similar inhibition of IL-1β mRNA expression at both 1 μM and 10 μM (Fig. 2A pink bars).DEX (50 nM) was used as an anti-inflammatory comparator [36,37]. Overall, AlloP and ent-AlloP exhibited effective anti-inflammatory effects when compared to DEX (blue bars in Fig. 2A). The results with IL1-β transcription were largely paralleled with another pro-inflammatory cytokine, IL-6. (Fig. 2B); effects of neuroactive steroids on TNF-α were not as apparent (Fig. 2C). Compounds in the absence of LPS failed to alter cytokine transcription at either 1 μM or 10 μM (Supplemental Figure 1B).

To verify that concentrations of neuroactive steroids chosen represented full effect of steroids, we examined concentrations of 0.03, 0.1, 0.3 and 1 μM for active compounds AlloP and ent-AlloP (Fig. 2D-I). We observed weak concentration dependence of neuroactive steroids in the context of LPS-induced inflammation and conclude the effects are near maximum but incomplete at 10 μM.

3.2. Structure-activity profile of other steroid structures and their enantiomers on LPS-induced inflammatory responses

To explore the structure-activity relationship of neuroactive steroids for anti-inflammatory effects, we selected a group of compounds representing distinct categories of structures and differing impacts on GABA_A receptors (Figs. 1,3, Supplemental Table). Their effects on LPS-induced proinflammatory cytokine transcription were tested at 10 μM using qPCR for IL-6 as a representative cytokine. Fig. 3 shows the effect of steroids with a neutral impact on GABA_A receptors (at concentrations < ~5 μM; illustrated in grey bars), including progesterone [38], ent-progesterone, and Etio. The three compounds mildly suppressed IL-6 mRNA production. Etio, another neutral modulator of GABA_A receptors, and ent-Etio a positive modulator of GABA_A receptors, [39,40] also both suppressed IL-6 mRNA production (Fig. 3). Pregnenolone sulfate, a negative modulator of GABA_A receptors, and 3β5αP, 3β5βP barely impacted IL-6 mRNA expression induced by LPS challenge (Fig. 3 blue bars and light blue bars). AlloP served as an additional comparison of anti-inflammatory effects (right red bar) in an independent replication of results from Fig. 2. Furthermore, we confirmed that compounds alone, without LPS-induced inflammation, have no impact on the expression of IL-6 mRNA (Supplemental Figure 1 C). The pattern in Fig. 3 indicates a potential mild correlation between the anti-inflammatory effects and functional impacts on GABA_A receptors. The positive modulators ent-Etio and AlloP had the most robust anti-inflammatory effects, and negative allosteric modulators of GABA_A receptors had least effect.

3.3. Structure-activity profile of side-chain oxysterols on LPS-induced inflammation

Oxysterols are oxidized forms of cholesterols that play an important role in brain cholesterol homeostasis, neurodevelopment, and cell signaling [41,42]. Further, some assays have revealed complex effects of oxysterols on inflammation [43,44] and ionotropic glutamate receptors [30]. Thus, we broadened our scope and selected two of the most important groups: 24S-hydroxycholesterol (24S-HC) and 25-hydroxycholesterol (25-HC), to test in BV2 cells challenged with LPS. Our studies also included synthetic analogues of 24S-HC (SGE-201 and SGE-301), as well as ent-25-HC and the synthetic 25-HC analogue KK-129 [45].

Fig. 4 shows that 24S-HC, along with SGE-201 and SGE-301 did not counteract the elevated mRNA expression of IL-6 induced by LPS administration (orange bars). Similarly, 25-HC and ent-25-HC, along with the analogue KK-129, exhibited no impact on the transcriptional changes of IL-6 (Fig. 4 purple bars). Furthermore, oxysterol analogues alone, without LPS-induced inflammation, did not alter IL-6 mRNA expression (Supplemental Figure 1D).

3.4. Viability evaluation

An alternative explanation for the effect of neuroactive steroids is that they negatively impact cell survival in the presence of LPS to decrease cytokine levels. To test this possibility, we chose a set of compounds that elicited decreases in cytokine levels and repeated treatments, followed by Trypan Blue staining. After overnight treatment with LPS or LPS plus steroid, cell morphology and Trypan Blue uptake were examined by light microscopy. Quantitative evaluation of cell viability revealed no significant difference between the groups (Supplemental Figure 3 A & 3B). We also tested the possibility that compounds alone have impact on the cell viability (Supplemental Figure 3 C) and found no effect. Overall, we conclude that changes to cell survival cannot explain the decreased pro-inflammatory cytokine expression in the presence of neuroactive steroids.

3.5. Correlation of inflammatory cytokine IL-6 protein in BV2 cell culture medium with its transcription

Finally, to ensure that transcription assays in Figs. 2-4 reflect protein expression in the experiments, we evaluated the correspondence between transcriptional results and protein expression of pro-inflammatory cytokines found in BV2 culture medium. We used a predesigned MilliPlex of 32 mouse cytokines to measure the contents in the culture medium. The samples selected for protein analysis were matched with their real-time qPCR assay samples (n = 6 platings). We focused in IL-6 as the most reliable pro-inflammatory transcriptional marker (Fig. 2). Fig. 5 exhibits a strong linear correlation between cytokine IL-6 protein production and their mRNA expression, indicating that the transcriptional changes observed are reflected at the protein level. Fig. 5B-D shows IL-6 and IL1-β are significant toward an effect of AlloP and ent-AlloP on other pro-inflammatory cytokines as well, paralleling the effect on RNA levels in earlier figures.