Abstract
Severe myoclonic epilepsy of infancy (SMEI) is a rare disorder that occurs in isolated patients. The disease is characterized by generalized tonic, clonic, and tonic-clonic seizures that are initially induced by fever and begin during the first year of life. Later, patients also manifest other seizure types, including absence, myoclonic, andsimple and complex partial seizures. Psychomotor development stagnates around the second year of life. Missense mutations in the gene that codes for a neuronal voltage-gated sodium-channel α-subunit (SCN1A) were identified in families with generalized epilepsy with febrile seizures plus (GEFS+). GEFS+ is a mild type of epilepsy associated with febrile and afebrile seizures. Because both GEFS+ and SMEI involve fever-associated seizures, we screened seven unrelated patients with SMEI for mutations in SCN1A. We identified a mutation in each patient: four had frameshift mutations, one had a nonsense mutation, one had a splice-donor mutation, and one had a missense mutation. All mutations are de novo mutations and were not observed in 184 control chromosomes.
Introduction
Severe myoclonic epilepsy of infancy (SMEI) was first described by Dravet in 1978 and is included as an epileptic syndrome in the International League Against Epilepsy (ILAE) classification, which was proposed by the Commission on Classification and Terminology of the ILAE (1989). Early manifestations of the disease are tonic, clonic, and tonic-clonic seizures that occur within the first year of life. These seizures are often prolonged, generalized, and associated with fever. Later in life, patients with SMEI have afebrile seizures, including myoclonic, tonic-clonic, absence, and simple and complex partial seizures. Early psychomotor and speech development is normal, but developmental stagnation occurs during the second year of life. Patients often become ataxic, and speech development is delayed. In general, SMEI is very resistant to all forms of pharmacotherapy.
A mild phenotype characterized by febrile seizures and, occasionally, epilepsy in adulthood was described by Scheffer and Berkovic (1997) as “generalized epilepsy with febrile seizures plus” (GEFS+) (MIM 604233). Two families with GEFS+ were reported to segregate missense mutations in the gene that codes for the α-subunit of a neuronal voltage-gated sodium channel (SCN1A) located on chromosome 2q (Escayg et al. 2000). Both mutations are within the transmembrane segments DII S4 and DIV S4 (fig. 1), which are voltage sensors of the channel. Recently, additional families with GEFS+ were reported to have novel missense mutations in SCN1A (Escayg et al. 2001; Wallace et al. 2001), which were located in the linker between DII and DIII and in the DI S2-S3 loop, DIII S5, and DIV S4 (fig. 1).
Figure 1.
Organization of SCN1A. The neuronal voltage-gated sodium-channel α-subunit SCN1A is a monomer and consists of four homologous domains (DI–DIV). Each domain has six transmembrane segments (S1–S6). S4 has several positively charged amino acids and represents the voltage sensor. P = the pore loop, which delineates the pore of the channel. Mutations identified in this study (described in table 2) were denoted as follows: asterisks (*) = deletion, insertion and nonsense mutations; diamond (♦) = missense mutation; circles (●) = GEFS+ missense mutations reported by Escayg et al. (2000, 2001); and squares (▪) = GEFS+ missense mutations reported by Wallace et al (2001).
Because fever-induced seizures occur both in GEFS+ and SMEI, we screened SCN1A for mutations in seven patients with SMEI.
Subjects and Methods
Subjects
We studied seven Belgian patients with SMEI, diagnosed according to the criteria of the Commission on Classification and Terminology of the ILAE (1989). DNA was extracted from peripheral blood of the seven patients, their unaffected parents, and 92 healthy control persons randomly selected from the Belgian population. The study was approved by the Commission for Medical Ethics of the University of Antwerp.
Human SCN1A
We defined the exon-intron boundaries of SCN1A by aligning the genomic sequence contained in BAC clone RP11-2I8 (Genbank accession number AC010127), the cDNA sequence of SCN8A (Genbank accession number XM_006838), and the protein sequence of SCN1A (Escayg et al. 2000). Recently, the complete cDNA and protein sequence of SCN1A was submitted to Genbank (accession numbers AF225985 and AAK00217). This sequence represents an alternatively spliced form of SCN1A that was described by Schaller et al. (1992). The protein sequence published by Escayg et al. (2000) contains an additional 11 amino acids at the 3′ end of exon 11, which encode part of the cytoplasmatic loop between DI and DII.
Mutation Detection and Molecular-Genetic Analysis
Intronic primer pairs were designed for each of the 26 exons, on the basis of the genomic sequence, using the Primer3 program (table 1). Exons and splice-site junctions were amplified using PCR, from 10 ng genomic DNA in a standard PCR procedure that used Platinum Taq (Life Technologies). Next, PCR fragments were denatured at 95°C for 4 min, were slowly cooled to room temperature, and subsequently were analyzed by denaturing high performance liquid chromatography (DHPLC) on the WAVE automated instrument (Transgenomic), as described elsewhere (Underhill et al. 1997). Each fragment with an aberrant DHPLC pattern was purified using the PCR product presequencing kit (USB). Subsequently, the products were sequenced using the BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems) and forward and reverse primers. Sequence reactions were performed on an ABI 3700 automated sequencer (PE Applied Biosystems). Data were collected and analyzed using the ABI DNA sequence analysis software, version 3.6.
Table 1.
Sequence of the Intronic Primers (5′→3′) Used for the Mutation Analysis of SCN1A
| Exon | 5′ Primer (Forward) | 3′ Primer (Reverse) | No. of Base Pairs in PCR Product |
| 1 | TCATGGCACAGTTCCTGTATC | GCAGTAGGCAATTAGCAGCAA | 589 |
| 2 | TGGGGCACTTTAGAAATTGTG | TGACAAAGATGCAAAATGAGAG | 391 |
| 3 | GCAGTTTGGGCTTTTCAATG | TGAGCATTGTCCTCTTGCTG | 314 |
| 4 | AGGGCTACGTTTCATTTGTATG | TGTGCTAAATTGGAATCCAGAG | 421 |
| 5 | CAGCTCTTCGCACTTTCAGA | TCAAGCAGAGAAGGATGCTGA | 307 |
| 6 | AGCGTTGCAAACATTCTTGG | GGGATATCCAGCCCCTCAAG | 477 |
| 7 | GACAAATACTTGTGCCTTTGAATG | ACATAATCTCATACTTTATCAAAAACC | 362 |
| 8 | GAAATGGAGGTGTTGAAAATGC | AATCCTTGGCATCACTCTGC | 581 |
| 9 | AGTACAGGGTGCTATGACCAAC | TCCTCATACAACCACCTGCTC | 440 |
| 10 | TCTCCAAAAGCCTTCATTAGG | TTCTAATTCTCCCCCTCTCTCC | 544 |
| 11 | TCCTCATTCTTTAATCCCAAGG | GCCGTTCTGTAGAAACACTGG | 670 |
| 12 | GTCAGAAATATCTGCCATCACC | GAATGCACTATTCCCAACTCAC | 372 |
| 13 | TGGGCTCTATGTGTGTGTCTG | GGAAGCATGAAGGATGGTTG | 543 |
| 14 | TACTTCGCGTTTCCACAAGG | GCTATGCAGAACCCTGATTG | 433 |
| 15 | ATGAGCCTGAGACGGTTAGG | ATACATGTGCCATGCTGGTG | 544 |
| 16 | TGCTGTGGTGTTTCCTTCTC | TGTATTCATACCTTCCCACACC | 658 |
| 17 | AAAAGGGTTAGCACAGACAATG | ATTGGGCAGATATAATCAAAGC | 489 |
| 18 | CACACAGCTGATGAATGTGC | TGAAGGGCTACACTTTCTGG | 567 |
| 19 | TCTGCCCTCCTATTCCAATG | GCCCTTGTCTTCCAGAAATG | 445 |
| 20 | AAAAATTACATCCTTTACATCAAACTG | TTTTGCATGCATAGATTTTCC | 395 |
| 21 | TGAACCTTGCTTTTACATATCC | ACCCATCTGGGCTCATAAAC | 579 |
| 22 | TGTCTTGGTCCAAAATCTGTG | TTGGTCGTTTATGCTTTATTCG | 283 |
| 23 | CCCTAAAGGCCAATTTCAGG | ATTTGGCAGAGAAAACACTCC | 378 |
| 24 | GAGATTTGGGGGTGTTTGTC | GGATTGTAATGGGGTGCTTC | 600 |
| 25 | CAAAAATCAGGGCCAATGAC | TGATTGCTGGGATGATCTTG | 483 |
| 26a | AGGACTCTGAACCTTACCTTGG | TGTACATGTTCACCACAACCAG | 589 |
| 26b | TGTGGGAACCCATCTGTTG | CCATGAATCGCTCTTCCATC | 418 |
| 26c | TGCTTTTACAAAGCGGGTTC | GTTTGCTGACAAGGGGTCAC | 592 |
We used pyrosequencing, as described by Alderborn et al. (2000), or PCR-RFLP analysis to screen the control population for the presence of the SCN1A mutations observed in the patients. The following primers were used for pyrosequencing: 5′-AAATCGTCTTCAATGCTCGG-3′ (c.657-658delAG), 5′-GAAATCGTCTTCAATG-3′ (c.664C→T), 5′-AGAAGCAAGGCCAGAAAG-3′ (c.2956C→T), 5′-GTTGAAAAATACATTATTG-3′ (c.3299-3300insAA), 5′-TGTATGCAGCAGTTGATTCC-3′ (IVS22+1G→A), and 5′-CAATCTGCCACAACCAAA-3′ (c.5536-5539delAAAC). The restriction enzyme HincII was used for the PCR-RFLP, thereby cutting the wild-type 589-bp fragment of exon 26a into fragments of 483 and 106 bp. The c.5010-5013delGTTT mutation creates an extra HincII restriction site in exon 26a, and digestion of the fragment results in three fragments, of 254, 225, and 106 bp.
The SCN1A mutations were described according to the nomenclature established by den Dunnen and Antonarakis (2000), and numbering was started from the initiating ATG codon, as described by Escayg et al. (2000).
Paternity Testing
We genotyped D21S188, a multiallelic microsatellite marker on chromosome 21p (Wang et al. 1999). This marker shows an average of 16 distinct alleles derived from eight chromosomes. In addition, we genotyped several highly informative microsatellite markers on chromosomes 17 (D17S785, D17S802, and D17S1847) and 18 (D18S51, D18S68, and D18S465). Heterozygosity frequencies of the chromosome 17 and 18 markers are 74%–89% (CEPH genotype database).
Results
SCN1A Mutation Analysis
All 26 exons and exon-intron boundaries of SCN1A were analyzed for mutations in seven patients with SMEI by DHPLC analysis of PCR-amplified fragments (table 1). In each patient with SMEI, we observed a single aberrant SCN1A fragment (table 2). Subsequent sequence analysis identified a heterozygous mutation in each patient: three out-of-frame deletions; one insertion; and one nonsense, one splice-donor, and one missense mutation (fig. 2). Table 2 summarizes the mutation data, and figure 1 illustrates the location of the mutations within the SCN1A protein. The deletions and insertion result in a frameshift with a premature stop codon: c.657-658delAG, c.3299-3300insAA, c.5010-5013delGTTT, and c.5536-5539delAAAC. The 5′ splice-site mutation (IVS22+1G→A) most likely leads to either exon skipping or use of a cryptic splice-donor site. A potential splice-donor consensus GT starts at IVS22+45, which, if used, results in a premature stop codon in exon 23. The missense mutation c.2956C→T results in a change from leucine to phenylalanine amino acid. The leucine at codon 986 is highly conserved among paralogical and orthological sodium-channel α-subunits (fig. 3). Most likely the L986F causes severe damage to SCN1A.
Table 2.
SCN1A Mutations in Patients with SMEI
| Patient Number | Location in SCN1A | DNA Changea | Position in SCN1A | Mutation | Protein Change |
| EP 153 | Exon 5 | c.657-658delAG | DI S4 | Frameshift, premature stop codon | S219fsX275 |
| EP 78 | Exon 5 | c.664C→T | DI S4 | Premature stop codon | R222X |
| EP 147 | Exon 16 | c.2956C→T | DII S6 | Missense mutation | L986F |
| EP 91 | Exon 16 | c.3299-3300insAA | DII-DIII linker | Frameshift, premature stop codon | K1100fsX1107 |
| EP 64 | Intron 22 | IVS22+1G→A | DIII S5-S6 pore | Splice donor | − |
| EP 90 | Exon 26 | c.5010-5013delGTTT | DIV S4-S5 loop | Frameshift, premature stop codon | L1670fsX1678 |
| EP 89 | Exon 26 | c.5536-5539delAAAC | C-terminal | Frameshift, premature stop codon | S1846fsX1856 |
Numbering of mutations started from the initiating ATG codon, as described by Escayg et al. (2000).
Figure 2.
Chromatograms of the SCN1A mutations in comparison with SCN1A wild-type sequences. Exonic sequences are in uppercase; intronic sequences are in lowercase.
Figure 3.
Evolutionary conservation of SCN1A. Sequence alignment and evolutionary conservation of the 986L residue (boxed).
We used sequencing analysis to determine whether any patient's mutation was present in either of the unaffected parents. In all cases, the mutation was absent from the parents. Also, for all patients, paternity was confirmed using several microsatellite markers. For each mutation (except for the c.5010-5013delGTTT mutation), we developed a pyrosequencing assay and showed that the mutations were absent from 92 control individuals. The c.5010-5013delGTTT mutation creates a new HincII restriction site, and we used PCR-RFLP to show that the mutation was absent in 92 control individuals (data not shown).
Phenotype of Patients with SMEI
Among the seven patients with SMEI, the age at onset of disease was 2–6 mo (table 3). In all patients, the earliest seizures were generalized; in four of the seven patients, these seizures were associated with fever. Subsequent seizures included secondary generalized tonic-clonic, myoclonic, absence, and simple and complex partial seizures. In all patients, the seizures were resistant to therapy. All patients became mentally retarded, and five patients have ataxia. One patient died at the age of 4 years.
Table 3.
Clinical Features of Seven Patients with SMEI with Mutations in SCN1A[Note]
|
Data for Patients |
|||||||
| Patient Characteristic | EP 64 | EP 78 | EP 89 | EP 90 | EP 91 | EP 147 | EP153 |
| Sex | Male | Male | Male | Female | Female | Female | Male |
| Year of birth | 1994 | 1994 | 1988 | 1995 | 1992 | 1998 | 1990 |
| Race | White | White | White | White | White | White | White |
| Status at birth | Normal | Normal | Normal | Normal | Normal | Normal | Normal |
| Family history: | |||||||
| Consanguinity | − | − | − | − | − | − | − |
| Febrile seizures | − | Paternal uncle | − | Mother | − | − | Maternal niece |
| Epilepsy | − | − | − | − | Maternal niece, paternal uncle | − | − |
| First seizure: | |||||||
| Age | 5 mo | 6 mo | 2 mo | 4 mo | 4 mo | 4 mo | 3 mo |
| Type | GTCS | GCS | GTS | GTCS | GCS | GTCS | GTCS |
| Fever-associated | + | − | − | − | + | + | + |
| Other seizures: | |||||||
| Secondary GTCS | + | + | + | + | + | + | + |
| Myoclonic seizures: | + | + | + | + | + | + | + |
| Age at onset | >7 mo | >10 mo | >3 mo | >12 mo | >8 mo | >12 mo | >3 years |
| Frequency | Daily | Daily | Daily | Rarely | Daily | Rarely | Rarely |
| Other seizures | CPS | Abs | − | Abs | − | Abs, SPS | Abs |
| Other features: | |||||||
| Therapy-resistant | + | + | + | + | + | + | + |
| Mental retardation | Moderate | Moderate | Severe | Severe | Severe | Moderate | Moderate |
| Ataxia | ± | + | + | − | − | + | + |
| Age at last examination | 6 years | 6 years | 10 years | 5 years | 6 years | 2 years | 4 yearsa |
Note.— −= absent; + = present; ± = probably present; GTCS= generalized tonic-clonic seizures; GCS = generalized clonic seizures; GTS = generalized tonic seizures; Abs = absence seizures; SPS = simple partial seizures; CPS = complex partial seizures.
Died at age 4 years.
Discussion
In seven patients with SMEI, we identified a heterozygous mutation in SCN1A that was absent in their parents, thereby providing substantial evidence that (1) SMEI has a genetic etiology and (2) de novo mutations in SCN1A are probably a major cause of SMEI. Heterozygous SCN1A mutations have also been reported in families with autosomal dominant GEFS+. However, all GEFS+ mutations are missense mutations that display reduced penetrance. In contrast, all cases of SMEI occur in isolated patients. The difference in phenotype and severity is reflected in the nature of SCN1A mutations identified in patients with SMEI. In five of seven patients with SMEI, we identified frameshift deletions (c.657-658delAG, c.5010-5013delGTTT, c.5536-5539delAAAC) or an insertion (c.3299-3300insAA) or a nonsense mutation (c.664C→T). Also, in one patient with SMEI, we identified a G→A transition in the conserved GT consensus sequence of the splice-donor site of intron 22. The consequence of this mutation can only be elucidated by analyzing the mutated transcript or protein. In one patient with SMEI, we identified a missense mutation at codon 986 (L986F), which is located within domain DII S6 of the SCN1A protein. Since codon 986 is highly conserved among α-subunits of human and other species, it can be predicted that this mutation may have a deleterious effect on SCN1A.
Thus, in the majority of patients with SMEI, the mutation results in early termination of translation, thereby producing a C-truncated SCN1A protein from one of the SCN1A alleles. Rapid degradation of these truncated transcripts or proteins could lead to a loss of function comparable with haploinsufficiency. Alternatively, some of the transcripts could lead to abnormal proteins with a toxic increase in function. In this respect, it is of intrest that heterozygous knockout mice for three voltage-gated sodium-channel α-subunits (SCN2A+/−, SCN8A+/−, and SCN10A+/−) do not display an abnormal phenotype and appear to develop normally. In contrast, homozygous knockout mice for these genes have a severe phenotype. SCN2A−/− mice die, as a result of severe hypoxia and extensive neuronal cell death, within 1–2 d of birth (Planells-Cases et al. 2000). SCN8A−/− mice display a paralytic phenotype, with muscle atrophy and ataxia, and die ⩽4 wk after birth (Burgess et al. 1995). SCN10A is a sensory-neuron–specific voltage-gated sodium channel. SCN10A−/− mice have partial deficits in perception of noxious thermal, mechanical, and inflammatory stimuli (Akopian et al. 1999). Given these observations, we conclude that the analysis of mutant transcripts and proteins is necessary for elucidation of the exact pathogenetic mechanism of heterozygous SCN1A mutations in patients with SMEI.
Acknowledgments
The authors thank the patients and their relatives for their cooperation and participation in this study. We are grateful to Hubert Backhovens, Dirk Van Den Bossche, and Sam Sluijs, for expert technical assistance, and to Dirk Snyders, for interesting and helpful discussions. This research was supported by the Fund for Scientific Research–Flanders (FWO-Belgium). L.C. is funded by a doctoral fellowship from the University of Antwerp.
Electronic-Database Information
Accession numbers and URLs for data in this article are as follows:
- Genbank, http://www.ncbi.nlm.nih.gov/Genbank (for genomic clone containing SCN1A [accession number AC010127], human SCN1A [for cDNA accession number AF225985, for protein accession number AAK00217], Rattus norvegicus Scn1a [accession number AAA79965], human SCN2A [accession number NP_066287], human SCN3A [accession number AAK00219], Rattus norvegicus Scn3a [accession number NP_037251], human SCN4A [accession number NP_000325], human SCN5A [accession number NP_000326], human SCN6A [accession number NP_002967], human SCN8A [for cDNA accession number XM_006838, for protein accession number XP_006838], human SCN9A [accession number NP_002968], human SCN10A [accession number NP_006505], human SCN11A [accession number AAF17480], human SCN12A [accession number NP_054858], Takifugu rubripes [accession number BAA07195], Loligo opalescens [accession number AAA16202], Electrophorus electricus [accession number CAA25587], Drosophila melanogaster [accession number AAB59192])
- Online Mendelian Inheritance in Man (OMIM), http://www.ncbi.nlm.nih.gov/Omim/ (for GEFS+ [MIM 604233])
- Primer3 program, http://www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi
- CEPH genotype database, http://www.cephb.fr/cephdb/dumps.html [Google Scholar]
References
- Akopian AN, Souslova V, England S, Okuse K, Ogata N, Ure J, Smith A, Kerr BJ, McMahon SB, Boyce S, Hill R, Stanfa LC, Dickenson AH, Wood JN (1999) The tetrodotoxin-resistant sodium channel SNS has a specialized function in pain pathways. Nat Neurosci 2:541–548 [DOI] [PubMed] [Google Scholar]
- Alderborn A, Kristofferson A, Hammerling U (2000) Determination of single-nucleotide polymorphisms by real-time pyrophosphate DNA sequencing. Genome Res 10:1249–1258 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Burgess DL, Kohrman DC, Galt J, Plummer NW, Jones JM, Spear B, Meisler MH (1995) Mutation of a new sodium channel gene, Scn8a, in the mouse mutant “motor endplate disease.” Nat Genet 10:461–465 [DOI] [PubMed] [Google Scholar]
- Commission on Classification and Terminology of the International League Against Epilepsy (1989) Proposal for revised classification of epilepsies and epileptic syndromes. Epilepsia 30:389–399 [DOI] [PubMed] [Google Scholar]
- den Dunnen JT, Antonarakis SE (2000) Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat 15:7–12 [DOI] [PubMed] [Google Scholar]
- Dravet C (1978) Les épilepsies graves de l’enfant. Vie Med 8:543–548 [Google Scholar]
- Escayg A, MacDonald BT, Meisler MH, Baulac S, Huberfeld G, An-Gourfinkel I, Brice A, LeGuern E, Moulard B, Chaigne D, Buresi C, Malafosse A (2000) Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet 24:343–345 [DOI] [PubMed] [Google Scholar]
- Escayg A, Heils A, MacDonald BT, Haug K, Sander T, Meisler MH (2001) A novel SCN1A mutation associated with generalized epilepsy with febrile seizures plus—and prevalence of variants in patients with epilepsy. Am J Hum Genet 68:866–873 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Planells-Cases R, Caprini M, Zhang J, Rockenstein EM, Rivera RR, Murre C, Masliah E, Montal M (2000) Neuronal death and perinatal lethality in voltage-gated sodium channel αII-deficient mice. Biophys J 78:2878–2891 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schaller KL, Krzemien DM, McKenna NM, Caldwell JH (1992) Alternatively spliced sodium channel transcripts in brain and muscle. J Neurosci 12:1370–1381 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Scheffer IE, Berkovic SF (1997) Generalized epilepsy with febrile seizures plus: a genetic disorder with heterogeneous clinical phenotypes. Brain 120:479–490 [DOI] [PubMed] [Google Scholar]
- Underhill PA, Jin L, Lin AA, Mehdi SQ, Jenkins T, Vollrath D, Davis RW, Cavalli-Sforza LL, Oefner PJ (1997) Detection of numerous Y chromosome biallelic polymorphisms by denaturing high-performance liquid chromatography. Genome Res 7:996–1005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wallace RH, Scheffer IE, Barnett S, Richards M, Dibbens L, Desai RR, Lerman-Sagie T, Lev D, Mazarib A, Brand N, Ben-Zeev B, Goikhman I, Singh R, Kremmidiotis G, Gardner A, Sutherland GR, George AL Jr, Mulley JC, Berkovic SF (2001) Neuronal sodium-channel α1-subunit mutations in generalized epilepsy with febrile seizures plus. Am J Hum Genet 68:859–865 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang SY, Cruts M, Del-Favero J, Zhang Y, Tissir F, Potier MC, Patterson D, Nizetic D, Bosch A, Chen H, Bennett L, Estivill X, Kessling A, Antonarakis SE, Van Broeckhoven C (1999) A high-resolution physical map of human chromosome 21p using yeast artificial chromosomes. Genome Res 9:1059–1073 [DOI] [PMC free article] [PubMed] [Google Scholar]