Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Dec 5.
Published before final editing as: J Am Chem Soc. 2023 Apr 10:10.1021/jacs.3c00829. doi: 10.1021/jacs.3c00829

Assessing Readability of an 8-letter Expanded DNA Alphabet with Nanopores

Christopher A Thomas 1, Jonathan M Craig 1, Shuichi Hoshika 2, Henry Brinkerhoff 1, Jesse R Huang 1, Sarah J Abell 1, Hwanhee C Kim 1, Michaela C Franzi 1, Jessica D Carrasco 1, Hyo-Joong Kim 2, Drew C Smith 1, Jens H Gundlach 1, Steven A Benner 2, Andrew H Laszlo 1,*
PMCID: PMC11619810  NIHMSID: NIHMS2038363  PMID: 37036666

Abstract

Chemists have now synthesized new kinds of DNA that add nucleotides to the four standard nucleotides (G, A, C, T) found in standard Terran DNA. Such “artificially expanded genetic information systems” are today used in molecular diagnostics, to support directed evolution to create medically-useful receptors, ligands, and catalysts, and to explore issues relating to the early evolution of life. Further applications are limited by an inability to directly sequence DNA containing unnatural nucleotides. Nanopore sequencing is well-suited for this purpose, as it does not require enzymatic synthesis, amplification, or nucleotide modification. Here, we take the first steps to realize nanopore sequencing of an 8-letter “hachimoji” expanded DNA alphabet by assessing its nanopore signal range using the MspA nanopore. We find Hachimoji DNA exhibits a broader signal range in nanopore sequencing than standard DNA alone and that hachimoji single base substitutions are distinguishable with high confidence. Because nanopore sequencing relies on a molecular motor to control the motion of DNA, we then assessed the compatibility of the Hel308 motor enzyme with non-standard nucleotides by tracking the translocation of single Hel308 molecules along hachimoji DNA, monitoring enzyme kinetics and premature enzyme dissociation from the DNA. We find that Hel308 is compatible with hachimoji DNA, but dissociates more frequently when walking over C-glycoside nucleotides, compared to N-glycosides. This robust effect that relates helicase performance to a specific structural feature highlights the need to optimize nanopore sequencing motors to handle different glycosidic bonds. It may also inform designs of future alternative DNA systems that can be sequenced with existing motors and pores.

Graphical Abstract

graphic file with name nihms-2038363-f0001.jpg

INTRODUCTION

DNA has long been seen to be the defining core of Terran life, constant in its structure, and perhaps also unique among molecules able to store, transmit, and evolve information. However, recent exploratory microbiology has discovered forms of life that use DNA built from nucleotides different from adenine, guanine, cytosine, and thymine1,2. Separately, synthetic chemists have created artificial genetic systems containing additional unnatural nucleotides, designed to add base pairs using molecular recognition systems that exploit hydrogen bonding3,4 or hydrophobic interactions5,6. One such system has been used to create a semi-synthetic life form7.

Hachimoji (Japanese meaning “eight letter”) nucleic acid (NA) is an eight-letter artificial genetic system consisting of four synthetic nucleotides (P, Z, B, and S) along with the four standard nucleotides (A, C, G and T). These form orthogonal base pairs (A:T, G:C, P:Z, and B:S) that follow both Watson-Crick pairing rules: hydrogen bonding and size complementarity (Figure 1A)8. These meet two structural requirements to support Darwinian evolution9, a polyelectrolyte backbone and size-shape regular building block that fit into an “aperiodic crystal”. Thus, hachimoji duplexes are joined with Watson-Crick base pairing geometry and adopt the familiar A & B helical forms seen in standard DNA10. Artificial genetic systems meeting these structural requirements can be used to evolve high-affinity aptamers8,11–14, enable highly multiplexed PCR15,16, and are used in commercial diagnostic kits testing for SARS-CoV-217, MERS18, Dengue virus19, Murine norovirus20, and others21.

Figure 1.

Figure 1.

Open in a new tab

(A) The eight-letter hachimoji genetic system consists of the four standard DNA bases (A,T,C,G) and the four additional non-standard bases (P,Z,B,S) that form four orthogonal Watson-Crick pairs through hydrogen bond complementarity. (B) A single MspA nanopore (yellow) is embedded in a lipid bilayer. A single DNA molecule bound to a Hel308 helicase (green) is drawn into the pore by an electric field. The ion current through the pore is modulated by the bases in the pore constriction and is measured to both sequence the strand and monitor the progression of a Hel308 molecule along the DNA template. The applied voltage V can be a constant offset (Figure 2A, Figure 3) or a periodic offset (Figure 2B–C). (C) Raw data trace of a hachimoji DNA template. Because Hel308 walks 3′ to 5′ along the DNA, we observe effects of the non-standard nucleotides first in ion current as they pass through the pore, then in enzyme behavior as they pass through the Hel308 helicase.

Synthesizing hachimoji NAs using solid-phase chemistry has now been developed to the point where it is routine6,22,23. However, commercial “next-generation” deep sequencing platforms are not designed to sequence hachimoji NAs. Accordingly, the sequences of such DNA are presently determined by transliteration strategies that convert hachimoji nucleotides into standard nucleotides following predictable pathways24. This has, for example, enabled deep sequencing six-letter GACTZP DNA molecules that have been evolved to bind cancer cells25, block the action of toxins11, and cleave RNA with sequence specificity26. Other conceivable sequencing approaches might include mass spectrometry7 and sequencing by hybridization27.

Therefore, nanopore sequencing28 is an attractive option for sequencing non-standard DNA. It has single molecule sensitivity and does not require polymerases that PCR amplify hachimoji sequences. The success of nanopore sequencing in detecting base modifications such as methylated cytosine29–33, base adducts34,35, and base isomers such as pseudouridine36,37 is auspicious. Beyond nucleic acids, nanopore techniques are being developed for peptide sequencing38,39. Nanopore sequencing has been applied to the 6-letter artificial genetic system containing a non-Watson-Crick pair between two hydrophobic nucleotides, termed dTPT3-dNaM40,41. Recent computational efforts have hinted at potential hachimoji nucleotide sensing with solid-state nanopores42.

In standard nanopore strand sequencing28,43,44, a single nanoscale pore (nanopore) is inserted into a membrane and forms the sole electrical connection between two electrolyte reservoirs (Figure 1B). A voltage applied across the membrane establishes an ion current through the pore which is measured. Negatively charged NA molecules coupled to a motor enzyme are captured by the electric field near the pore until the enzyme rests on the rim of the pore. The enzyme controls NA motion through the pore by translocating along the strand in discrete steps. The bases in the narrowest part of the pore (constriction) block the ion current in a sequence-dependent manner, enabling nanopore sequencing28,44–46 and providing a precise measurement of the enzyme’s position on the NA template over time47,48.

Here, we set out to address challenges that might come when attempting to sequence hachimoji DNA with nanopores. Since hachimoji bases have chemical structures similar to standard bases, it was not obvious that nanopore signals from P, Z, S, and B would be sufficiently distinguishable from standard base signals to allow sequencing.

Further, the measured ion current in nanopore sequencing is the result of current blockages by 4–6 consecutive bases in or near the pore constriction (referred to as k-mers)45,46, Therefore, decoding sequences requires current values associated with various k-mers to be sufficiently distinguishable. The difficulty of nanopore sequencing scales exponentially with the number of base letters in a genetic alphabet (e.g. a 6-base k-mer model requires decoding 4096 unique k-mers for a four-letter alphabet and 262,144 k-mers for an eight-letter alphabet). Sequencing of such an alphabet requires empirical measurements of each k-mer in multiple sequence contexts to develop a current-to-sequence model, requiring significant laboratory time and resources for library construction and analysis. In addition, the ion current levels of these k-mers will have significant overlap with one another within the limited dynamic range of the nanopore ion current, possibly making unique k-mer discrimination intractable.

For these reasons, sequencing of base modifications in DNA (e.g. methylation) and RNA (e.g. pseudouridine) has often relied on comparisons of nanopore signals to similar reads of unmodified NA rather than de novo detection of the modified nucleotide29,30,37. The “kmer explosion” created by the expansion of the DNA alphabet necessitates novel nanopore technologies capable of extracting additional signal features beyond average ion current, such as variable voltage sequencing40,46. Additionally, nanopore sequencing of unnatural nucleotides require an enzyme capable of processing them without introducing sequencing errors.

Prior to the significant investment required in building a nanopore k-mer model for hachimoji DNA, we must assess whether the four added nucleotides have a distinguishable effect on the nanopore signal. We must also assess their compatibility with sequencing motor enzymes. The Oxford Nanopore Technologies (ONT) sequencing devices are commercially available and have high-throughput, long reads, and high accuracy49. Despite these advantages, ONT platforms use only ion current data from a single applied voltage, limiting their utility for sequencing expanded alphabets. The motor enzyme is proprietary, highly optimized for sequencing of canonical bases, and cannot be easily modified/optimized for expanded DNA alphabets. Further, ONT from time to time changes its enzymes and pore to optimize standard-base sequencing, and that change may impact the reading of non-standard nucleotides in an unpredictable way.

For these reasons, we chose to investigate the feasibility of sequencing hachimoji DNA with variable-voltage sequencing on the MspA nanopore. We both measure the nanopore ion current conductance of hachimoji DNA and track the translocation of the Hel308 motor enzyme (commonly used in nanopore sequencing38,40,41,46) to assess enzyme/hachimoji compatibility. We also demonstrate proof-of-concept hachimoji reference-sequencing by distinguishing single base substitutions of each hachimoji base with high confidence using variable-voltage nanopore sequencing.

MATERIAL AND METHODS

Pore Establishment

A single M2-NNN-MspA nanopore was established in a 1,2-di-O-phytanyl-sn-glycero-3-phosphocholine (DOPHPC) lipid bilayer using methods that have been well established50,51. Lipids were ordered from Avanti Polar Lipids.

DNA Preparation

AEGIS phosphoramidites (Firebird Biomolecular Sciences LLC. www.firebirdbio.com) were used in solid phase oligonucleotide synthesis on an ABI 394 instrument to make the non-standard DNA molecules. Oligonucleotides were purified on 10% denatured PAGE and then desalted on C18 Sep-Pak cartridge. A complementary DNA strand was annealed to the template DNA strand to give the template a free 5′ end and an 8-base 3′ overhang. Hel308 binds to this 8-base overhang and can begin to unwind dsDNA in solution, meaning that a nanopore read can start at any location along the DNA molecule, although most reads begin near the start (3′ end) of the DNA sequence. The DNA sequences for the template strands are listed in Table S1.

The DNA sequence for the complementary strand is:

5′ CCTGCATGAGTTGTCTGCCGTGXXXX/chol/ 3′, where /chol/ is a cholesterol tag to facilitate binding of the DNA to the bilayer to increase the interaction rate of DNA with the nanopore and ‘X’ is an 18-carbon spacer. This complement was used for each sequence in this study.

Proteins

Hel308 from Thermococcus gammatolerans EJ3 (accession number WP_015858487.1) and M2-NNN MspA (accession number CAB56052.1) were expressed using standard techniques using in-house facilities.

Nanopore Experiment

Negatively charged DNA molecules coupled to a Hel308 helicase are captured by the electric field near the pore. At the beginning of a read, the 5′ end of the DNA template is drawn into the pore until Hel308 comes to rest on the pore rim. As only ssDNA fits through the pore constriction, the complement strand is sheared from the template strand, leaving only ssDNA (Figure S1). Hel308 bound to the DNA will translocate from 3′ to 5′ in discrete steps approximately half a nucleotide in length47, drawing the ssDNA out of the pore. While in principle it is possible for the 3′ end of the DNA to feed into the pore, no such events were observed. To prevent accumulation of ADP in bulk, we perfused new reagents into the cis well every 45 minutes. In some experiments we replaced the constant applied voltage with a periodic voltage waveform (200 Hz triangle wave, 100mV peak-to-peak offset to 150mV) which repeatedly stretches and relaxes DNA within the pore vestibule, “flossing” the DNA in the constriction by ±1 nt much faster than a typical Hel308 step (~10 Hz). This produces a sequence of conductance-voltage curves which contain more sequence information than current levels produced from constant voltage nanopore sequencing40,46.

Data Acquisition

Data was acquired with custom LabVIEW software on an Axopatch 200B amplifier at 50 kHz, and downsampled by averaging to 5 kHz. In variable-voltage experiments, we applied a 200 Hz, 100 mV peak-to-peak triangle waveform in addition to a constant 150 mV DC offset. In constant voltage experiments, we applied a constant 180 mV DC offset. A summary of all collected data can be found in Table S2.

Raw Data Analysis: In variable-voltage experiments, we processed the raw data as described in Section S1 and Figure S240,46. In constant voltage experiments, ion current versus time raw traces were processed and compiled into consensus patterns as described in Figure S347,48,50,52. Dwell-times and probability of backwards step were determined by aligning ion-current segments to the consensus sequence (Figure S4)48,53. Position of helicase dissociation was determined through the the same alignment strategy. Survival curves and dissociation probabilities were calculated from these positions (Section S2). Homopolymer conductances were analyzed as described in Section S3.

RESULTS

Hachimoji DNA has a large dynamic range of conductance in MspA and single base substitutions are distinguishable

We first measured the conductance signal of seven hachimoji ssDNA templates containing a 16 nt region of homopolymer A, T, C, P, Z, B, or S passed through the MspA nanopore under a constant applied voltage (Figure 2A, Figure S5–S6). Homopolymer G was omitted because of its tendency to form robust secondary structures, though we did opt to include homopolymer B despite its own tendency to form quadruplex and pentaplex secondary structures54,55. These structures may be resolved by the electrostatic force across the pore during measurement, though they may still contribute to larger noise and wider conductance distribution relative to the other homopolymers. The 3’-nitrogen of the Z heterocyclic ring is known to have a pKa of 7.826 in free solution, very close to the pH used in these experiments (pH 8). We speculate that protonation of Z may be related to the wide conductance distribution measured for homopolymer Z, as protonation kinetics are known to be observable as noise in nanopore experiments56.

Figure 2.

Figure 2.

Open in a new tab

(A) Histograms of constant-voltage conductance caused by translocation of DNA substrates containing 16 nucleotide homopolymers of each hachimoji base (excluding G). Homopolymers of P and Z give the lowest and highest conductance signal respectively, evidence that the hachimoji system has an expanded nanopore signal range relative to the standard alphabet. (B) Variable-voltage consensus patterns of hachimoji single base substitutions within a pseudorandom sequence. The sequence of conductance-voltage curves from variable-voltage nanopore sequencing contain more sequence information than the sequence of current levels produced from constant voltage sequencing40,46. (C) Confusion matrix of our base-calling algorithm’s accuracy shows that hachimoji single base substitutions are distinguishable with high confidence using variable-voltage nanopore sequencing. Reads are only included in base calling if they align to one of the consensus patterns with a confidence greater than 90%.

Homopolymer P gave the lowest measured conductance of the alphabet (0.22 ± 0.01 nS), while homopolymer Z gave the highest (0.68 ± 0.03 nS). The expanded conductance signal range compared to the standard alphabet is encouraging for further sequencing applications, as it suggests hachimoji k-mers may be spread out over a larger range of conductance and thus easier to distinguish.

We next generated a single stranded DNA hachimoji reference library with each template having a 65-mer sequence identical across templates except for a single nucleotide which contained one of the eight hachimoji bases. We constructed a variable-voltage consensus conductance pattern for each of the templates by averaging the patterns of 50 randomly selected variable-voltage reads (Figure 2B). We used a previously-developed base-calling algorithm40 to align each read to all eight consensus patterns, generating a likelihood that the read corresponds to each consensus (Section S4, Figure S7). A read is thus base-called by determining the consensus alignment that produced the maximum confidence. We excluded from base-calling reads used to construct the consensus patterns (50 reads each), as well as reads with a maximum consensus alignment confidence less than 90% (low confidence reads occupy 6% of our data). We achieve an accuracy >90% for all bases except for S (89.8%) (Figure 2C).

Translocation on consecutive C-glycoside nucleosides increases premature Hel308 dissociation from DNA

While measuring the conductance of hachimoji homopolymers, we observed that many of the reads terminated mid-sequence after processing only ~10 nucleotides. Considering the measured processivity (average number of nucleotides translocated in a single binding event) of Hel308 is about 1000 nt on genomic DNA46, this was interpreted as evidence of premature Hel308 dissociation from the DNA strand. As each nanopore sequencing read is a single-molecule record of a motor enzyme’s activity47,50, we tracked Hel308 molecules as they translocated on the hachimoji templates and measured the position at which Hel308 dissociates from the strand (Figure S8). We observed that Hel308 dissociated more often on homopolymers of S and Z compared to the rest of the templates (Figure 3A, Figure S9). S and Z are connected to the deoxyribose sugar by a carbon-carbon bond (C-glycoside), while P, B, A, T, C, and G are connected to the deoxyribose sugar by a carbon-nitrogen bond (N-glycoside).

Figure 3.

Figure 3.

Open in a new tab

(A) Hel308 survival functions from multiple single-molecule traces as a function of position along a DNA template containing a homopolymer of hachimoji bases. C-glycoside nucleosides are associated with higher dissociation (low survival) upon translocation by Hel308. Hel308 steps along the DNA template from 3′ to 5′ in steps approximately half a nucleotide in length. (B) Chemical structures of additional nucleotides used to further test the effects of glycosidic character. Bases are connected to the DNA backbone (red arrow) through a C-C bond in C-glycosides while N-glycosides are connected through a N-C bond. (C) Probability of Hel308 dissociation as a function of position on hachimoji mixed sequences. High dissociation occurs in windows of approximately four (top) and eight bases (bottom), matching the distribution of C-glycosides (S and Z underlined) within the sequences. Aligning the dissociation probability to sequence enables coarse-grained localization of the dissociation mechanism to 17 or 18 nucleotides upstream of the pore constriction.

To test the hypothesis that the C-glycoside character of S and Z influences Hel308 dissociation, we measured Hel308 dissociation on DNA templates of identical design as described above, but with homopolymer regions consisting of the nucleotides pseudothymidine (C-glycoside analogue of T, “pseudoT”), pseudoisocytidine (C-glycoside analogue of C, “pseudoisoC”), and isocytidine (N-glycoside analogue of S, “isoC”) (Figure 3B). Again, C-glycosides resulted in higher Hel308 dissociation (Figure 3A), indicating that the C- versus N-glycosidic status of the nucleotide appears to be a key determinant of this feature of the Hel308-DNA strand interaction.

Measurements of Hel308 dissociation may be sensitive to the quality of the DNA templates, as helicase dissociation may be influenced by known solid-phase synthesis error modes including DNA fragments or DNA chemical adducts. To rule out template impurity as the main source of our dissociation results, we conducted liquid chromatography-mass spectrometry (LCMS) analysis of a subset of our DNA templates (Section S5, Figure S10). This measurement indicated that 19 ± 9% of our DNA molecules were expected to have one or more impurities that might affect Hel308’s processivity (Table S3). This is well below the rate of Hel308 C-glycoside dissociation in which 50–80% of reads ended prematurely and suggests that the glycosidic composition of bases in our DNA templates is the primary cause of the observed differences in the survival curves.

In the same experiments characterizing Hel308 dissociation, we also measured Hel308’s dwell time and the probability of backwards stepping on the hachimoji DNA templates. We have previously measured these kinetic observables of Hel308 on standard DNA and have found they are highly dependent on the underlying ssDNA sequence53,57,58. Unsurprisingly, the non-standard hachimoji nucleotides also distinctly affect these Hel308 kinetic observables, with Z and B bases eliciting longer dwell times in most sequence contexts and P and B causing more backwards steps (Figure S11). C-glycosides do not uniquely cause longer dwell times and/or more frequent backsteps in Hel308 compared to N-glycosides, ruling out the alternate hypothesis that increased time spent on the DNA template with a constant dissociation rate is ultimately the cause of the high fraction of dissociations observed on C-glycosides.

Translocation over different PZBS sequence contexts hints at the location of the DNA-Hel308 contact causing dissociation

To further probe the C-glycoside dissociation mechanism, we measured Hel308 dissociation over DNA templates of identical design to those already described but with their homopolymer region replaced with a 16-nt mixed region composed of various combinations of non-standard hachimoji nucleotides. Of particular interest is the sequence with a region composed of dinucleotide repeats of each of the four non-standard nucleotides in the pattern: 5′-(ZZSSPPBB)x2-3′. The dissociation probability of Hel308 on this sequence is markedly higher over two separate four-nucleotide windows, with the two windows separated by approximately four nucleotides (Figure 3C). This behavior is consistent with the four-nucleotide-long C-glycoside windows present in the sequence, separated by four nucleotides of N-glycosides. Hel308 dissociation on the sequence 5′-ZZZZSSSSPPPPBBBB-3′ also shows high dissociation over a roughly eight-nucleotide window, consistent with the C-glycoside distribution of the sequence. The dissociation probability was related to the sequence at a distance 17 or 18 nt away from the pore constriction in both DNA templates, corresponding to the DNA sequence within Hel308 consistent with previous studies53. As Hel308 is known to contact DNA over a span of ~14 nucleotides59, this suggests that the site(s) within Hel308 that most influences C-glycoside dissociation is localized and only contacts 1 or 2 nucleotides instead of being distributed throughout the helicase. This also suggests that future work involving site-directed mutagenesis may be capable of improving Hel308 survival on C-glycosides.

DISCUSSION

These data show that the MspA nanopore system can detect and accurately distinguish all eight hachimoji bases, and that the nanopore conductance signal from hachimoji homopolymers occupies a larger dynamic range of conductance than the standard DNA alphabet. This increased dynamic range means that additional information can be gleaned from the nanopore signal despite the added difficulties of sequencing 8-letter DNA. In particular, the high currents produced by Z and low currents produced by P suggest that de novo sequencing of a 6-letter alphabet including A, C, G, T, P, and Z is a tractable problem.

Further, by distinguishing hachimoji single base substitutions with high confidence, these data show the feasibility of simultaneous direct detection of hachimoji nucleotides sparsely distributed within natural DNA. These are exactly the kinds of sequence generated by laboratory in vitro evolution (LIVE) applied to hachimoji libraries. Here the binding specificity and enzyme catalytic activity of aptamers and aptazymes can be greatly increased compared to standard NA through the addition of only a few hachimoji nucleotides8,11–14,26. This is one of many current and near-future applications of hachimoji NAs with sparse incorporation of hachimoji nucleotides.

Natural DNA includes additional non-canonical bases such as methylated nucleotides or lesions such as abasic residues which also manifest as ion current shifts in nanopore sequencing data. However, for many applications, only a limited set of possible sequences need be considered, e.g. a particularly prevalent base substitution or an abasic residue which results from a particular DNA repair pathway40. That the nanopore system shown here can distinguish among 8 separate hypotheses with high confidence suggests that it can be readily applied to probe hachimoji DNA extracted from live cells.

Denser patterns of hachimoji nucleotides will increase the combinatorial complexity of nanopore signals and will likely require new innovations to extract more information from the NA sequence. These include variable-voltage sequencing, frequency-domain analysis58, as well as future work to incorporate motor enzyme kinetics as an additional independent signal into base-calling algorithms. For example, here Hel308 shows strong sequence-dependent kinetics in response to hachimoji bases (Figure S11). As noncovalent nanopore-target interactions may affect the measured signal, one possibility is to design nanopores that interact with specific bases (such as the nitro group on Z), thus enhancing the current response in a base specific manner60. Sequencing and comparison of unmodified and transliterated NAs could also be used to glean additional information from the DNA24.

By tracking the position along the strand where Hel308 dissociates, we found that Hel308 is partially compatible with hachimoji nucleotides, translocating without issue on P and B bases while retaining reasonable processivity on sparsely distributed S and/or Z bases. We also found compelling evidence that the glycosidic character of nucleosides is a major predictor of premature Hel308 strand dissociation, with C-glycosides promoting more dissociation relative to N-glycosides. We speculate this could be due to the C-glycosides adopting a different sugar pucker10,61, a phenomenon in which the conformation of the deoxyribose sugar switches from C2′-endo to C3′-endo, decreasing the distance between neighboring phosphate groups along the DNA backbone62. We speculate that this may be an underlying mechanism by which Hel308 discriminates between DNA and RNA in vivo as DNA and RNA exhibit C2′-endo to C3′-endo pucker, respectively63.

By mutating Hel308 near the position where we localize the dissociation effect, we may be able to optimize Hel308 for use in C-glycoside nanopore sequencing. While the C-glycoside effect will hinder nanopore sequencing of S/Z-rich hachimoji templates actuated by wild type Hel308, the stochastic Hel308 C-glycoside dissociation rate of 12%-per-nucleotide (Figure S9) currently allows for sequencing strands with sparse S and Z composition or short sections (<20 nt) of S and Z. More work is needed to determine the mechanism of dissociation and whether other motor enzymes used for nanopore sequencing possess similar dissociation behavior. This work may also provide useful constraints in the development of future artificial genetic systems compatible with existing NA processing enzymes.

Supplementary Material

Supplementary Info

ACKNOWLEDGEMENT

We thank Sinduja K. Marx for expressing and purifying Hel308.

FUNDING

CAT, SH, SJA, MCF, JDC, JHG, SAB, and AHL were supported by an Opportunity Fund through the Technology Development Coordinating Center at Jackson Laboratories (National Human Genome Research Institute [U24HG011735]).

Hachimoji chemistry was developed under a grant from the National Science Foundation [MCB-1939086] and a grant from the National Institutes of General Medical Sciences [1R01GM141391-01A1].

JMC, JRH, and HCK were supported by the National Institutes of Health, National Human Genome Research Institute [R01HG005115].

Research reported in this publication was supported by the National Institutes of Health under the Director’s Award Number [R01GM128186]. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Funding for open access charge: [R01HG005115].

Footnotes

SUPPORTING INFORMATION

The Supporting Information is available free of charge at JACS online.

DATA AVAILABILITY

The data underlying this article are available in figshare and can be accessed with https://figshare.com/s/1a23062119aa22f33de2.

REFERENCES

  • (1).Pezo V; Jaziri F; Bourguignon P-Y; Louis D; Jacobs-Sera D; Rozenski J; Pochet S; Herdewijn P; Hatfull GF; Kaminski P-A; Marliere P Noncanonical DNA Polymerization by Aminoadenine-Based Siphoviruses. Science 2021, 372 (6541), 520–524. 10.1126/science.abe6542. [DOI] [PubMed] [Google Scholar]
  • (2).Zhou Y; Xu X; Wei Y; Cheng Y; Guo Y; Khudyakov I; Liu F; He P; Song Z; Li Z; Gao Y; Ang EL; Zhao H; Zhang Y; Zhao S A Widespread Pathway for Substitution of Adenine by Diaminopurine in Phage Genomes. Science 2021, 372 (6541), 512–516. 10.1126/science.abe4882. [DOI] [PubMed] [Google Scholar]
  • (3).Benner SA Understanding Nucleic Acids Using Synthetic Chemistry. Acc. Chem. Res 2004, 37 (10), 784–797. 10.1021/ar040004z. [DOI] [PubMed] [Google Scholar]
  • (4).Hirao I; Ohtsuki T; Fujiwara T; Mitsui T; Yokogawa T; Okuni T; Nakayama H; Takio K; Yabuki T; Kigawa T; Kodama K; Yokogawa T; Nishikawa K; Yokoyama S An Unnatural Base Pair for Incorporating Amino Acid Analogs into Proteins. Nature Biotechnology 2002, 20 (2), 177–182. 10.1038/nbt0202-177. [DOI] [PubMed] [Google Scholar]
  • (5).Henry AA; Romesberg FE Beyond A, C, G and T: Augmenting Nature’s Alphabet. Current Opinion in Chemical Biology 2003, 7 (6), 727–733. 10.1016/j.cbpa.2003.10.011. [DOI] [PubMed] [Google Scholar]
  • (6).Hikida Y; Kimoto M; Yokoyama S; Hirao I Site-Specific Fluorescent Probing of RNA Molecules by Unnatural Base-Pair Transcription for Local Structural Conformation Analysis. Nature Protocols 2010, 5 (7), 1312–1323. 10.1038/nprot.2010.77. [DOI] [PubMed] [Google Scholar]
  • (7).Malyshev DA; Dhami K; Lavergne T; Chen T; Dai N; Foster JM; Corrêa IR; Romesberg FE A Semi-Synthetic Organism with an Expanded Genetic Alphabet. Nature 2014, 509 (7500), 385–388. 10.1038/nature13314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (8).Hoshika S; Leal NA; Kim M-J; Kim M-S; Karalkar NB; Kim H-J; Bates AM; Watkins NE; SantaLucia HA; Meyer AJ; DasGupta S; Piccirilli JA; Ellington AD; SantaLucia J; Georgiadis MM; Benner SA Hachimoji DNA and RNA: A Genetic System with Eight Building Blocks. Science 2019, 363 (6429), 884. 10.1126/science.aat0971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (9).Benner SA Rethinking Nucleic Acids from Their Origins to Their Applications. Philosophical Transactions of the Royal Society B: Biological Sciences 2023, 378 (1871), 20220027. 10.1098/rstb.2022.0027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (10).Hoshika S; Shukla MS; Benner SA; Georgiadis MM Visualizing “Alternative Isoinformational Engineered” DNA in A- and B-Forms at High Resolution. J. Am. Chem. Soc 2022, 144 (34), 15603–15611. 10.1021/jacs.2c05255. [DOI] [PubMed] [Google Scholar]
  • (11).Biondi E; Lane JD; Das D; Dasgupta S; Piccirilli JA; Hoshika S; Bradley KM; Krantz BA; Benner SA Laboratory Evolution of Artificially Expanded DNA Gives Redesignable Aptamers That Target the Toxic Form of Anthrax Protective Antigen. Nucleic Acids Research 2016, 44 (20), 9565–9577. 10.1093/nar/gkw890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (12).Zhang L; Yang Z; Le Trinh T; Teng I-T; Wang S; Bradley KM; Hoshika S; Wu Q; Cansiz S; Rowold DJ; McLendon C; Kim M-S; Wu Y; Cui C; Liu Y; Hou W; Stewart K; Wan S; Liu C; Benner SA; Tan W Aptamers against Cells Overexpressing Glypican 3 from Expanded Genetic Systems Combined with Cell Engineering and Laboratory Evolution. Angewandte Chemie International Edition 2016, 55 (40), 12372–12375. 10.1002/anie.201605058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (13).Kimoto M; Yamashige R; Matsunaga K; Yokoyama S; Hirao I Generation of High-Affinity DNA Aptamers Using an Expanded Genetic Alphabet. Nature Biotechnology 2013, 31 (5), 453–457. 10.1038/nbt.2556. [DOI] [PubMed] [Google Scholar]
  • (14).Biondi E; Benner SA Artificially Expanded Genetic Information Systems for New Aptamer Technologies. Biomedicines 2018, 6 (2), 53. 10.3390/biomedicines6020053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (15).Yang Z; Chen F; Chamberlin S; Benner SA Expanded Genetic Alphabets in the Polymerase Chain Reaction. Angewandte Chemie International Edition 2010, 49 (1), 177–180. 10.1002/anie.200905173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (16).Yang Z; Durante M; Glushakova LG; Sharma N; Leal NA; Bradley KM; Chen F; Benner SA Conversion Strategy Using an Expanded Genetic Alphabet to Assay Nucleic Acids. Anal. Chem 2013, 85 (9), 4705–4712. 10.1021/ac400422r. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (17).Yang Z; Benner SA Compositions for the Multiplexed Detection of Viruses. US-20220162600-A1, November 23, 2020. [Google Scholar]
  • (18).Yaren O; Glushakova LG; Bradley KM; Hoshika S; Benner SA Standard and AEGIS Nicking Molecular Beacons Detect Amplicons from the Middle East Respiratory Syndrome Coronavirus. Journal of Virological Methods 2016, 236, 54–61. 10.1016/j.jviromet.2016.07.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (19).Glushakova LG; Bradley A; Bradley KM; Alto BW; Hoshika S; Hutter D; Sharma N; Yang Z; Kim M-J; Benner SA High-Throughput Multiplexed XMAP Luminex Array Panel for Detection of Twenty Two Medically Important Mosquito-Borne Arboviruses Based on Innovations in Synthetic Biology. Journal of Virological Methods 2015, 214, 60–74. 10.1016/j.jviromet.2015.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (20).Yaren O; Bradley KM; Moussatche P; Hoshika S; Yang Z; Zhu S; Karst SM; Benner SA A Norovirus Detection Architecture Based on Isothermal Amplification and Expanded Genetic Systems. Journal of Virological Methods 2016, 237, 64–71. 10.1016/j.jviromet.2016.08.012. [DOI] [PubMed] [Google Scholar]
  • (21).Glushakova LG; Sharma N; Hoshika S; Bradley AC; Bradley KM; Yang Z; Benner SA Detecting Respiratory Viral RNA Using Expanded Genetic Alphabets and Self-Avoiding DNA. Analytical Biochemistry 2015, 489, 62–72. 10.1016/j.ab.2015.08.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (22).Yang Z; Hutter D; Sheng P; Sismour AM; Benner SA Artificially Expanded Genetic Information System: A New Base Pair with an Alternative Hydrogen Bonding Pattern. Nucleic Acids Research 2006, 34 (21), 6095–6101. 10.1093/nar/gkl633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (23).Ogawa AK; Wu Y; McMinn DL; Liu J; Schultz PG; Romesberg FE Efforts toward the Expansion of the Genetic Alphabet: Information Storage and Replication with Unnatural Hydrophobic Base Pairs. J. Am. Chem. Soc 2000, 122 (14), 3274–3287. 10.1021/ja9940064. [DOI] [Google Scholar]
  • (24).Yang Z; Chen F; Alvarado JB; Benner SA Amplification, Mutation, and Sequencing of a Six-Letter Synthetic Genetic System. J. Am. Chem. Soc 2011, 133 (38), 15105–15112. 10.1021/ja204910n. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (25).Zhang L; Wang S; Yang Z; Hoshika S; Xie S; Li J; Chen X; Wan S; Li L; Benner SA; Tan W An Aptamer-Nanotrain Assembled from Six-Letter DNA Delivers Doxorubicin Selectively to Liver Cancer Cells. Angewandte Chemie International Edition 2020, 59 (2), 663–668. 10.1002/anie.201909691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (26).Jerome CA; Hoshika S; Bradley KM; Benner SA; Biondi E In Vitro Evolution of Ribonucleases from Expanded Genetic Alphabets. Proceedings of the National Academy of Sciences 2022, 119 (44), e2208261119. 10.1073/pnas.2208261119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (27).Lee KH; Hamashima K; Kimoto M; Hirao I Genetic Alphabet Expansion Biotechnology by Creating Unnatural Base Pairs. Current Opinion in Biotechnology 2018, 51, 8–15. 10.1016/j.copbio.2017.09.006. [DOI] [PubMed] [Google Scholar]
  • (28).Manrao EA; Derrington IM; Laszlo AH; Langford KW; Hopper MK; Gillgren N; Pavlenok M; Niederweis M; Gundlach JH Reading DNA at Single-Nucleotide Resolution with a Mutant MspA Nanopore and Phi29 DNA Polymerase. Nature Biotechnology 2012, 30 (4), 349–353. 10.1038/nbt.2171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (29).Laszlo AH; Derrington IM; Brinkerhoff H; Langford KW; Nova IC; Samson JM; Bartlett JJ; Pavlenok M; Gundlach JH Detection and Mapping of 5-Methylcytosine and 5-Hydroxymethylcytosine with Nanopore MspA. Proc Natl Acad Sci USA 2013, 110 (47), 18904–18909. 10.1073/pnas.1310240110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (30).Simpson JT; Workman RE; Zuzarte PC; David M; Dursi LJ; Timp W Detecting DNA Cytosine Methylation Using Nanopore Sequencing. Nature Methods 2017, 14 (4), 407–410. 10.1038/nmeth.4184. [DOI] [PubMed] [Google Scholar]
  • (31).Rand AC; Jain M; Eizenga JM; Musselman-Brown A; Olsen HE; Akeson M; Paten B Mapping DNA Methylation with High-Throughput Nanopore Sequencing. Nature Methods 2017, 14 (4), 411–413. 10.1038/nmeth.4189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (32).Schreiber J; Wescoe ZL; Abu-Shumays R; Vivian JT; Baatar B; Karplus K; Akeson M Error Rates for Nanopore Discrimination among Cytosine, Methylcytosine, and Hydroxymethylcytosine along Individual DNA Strands. Proceedings of the National Academy of Sciences 2013, 110 (47), 18910–18915. 10.1073/pnas.1310615110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (33).Wescoe ZL; Schreiber J; Akeson M Nanopores Discriminate among Five C5-Cytosine Variants in DNA. J. Am. Chem. Soc 2014, 136 (47), 16582–16587. 10.1021/ja508527b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (34).Nookaew I; Jenjaroenpun P; Du H; Wang P; Wu J; Wongsurawat T; Moon SH; Huang E; Wang Y; Boysen G Detection and Discrimination of DNA Adducts Differing in Size, Regiochemistry, and Functional Group by Nanopore Sequencing. Chem. Res. Toxicol 2020, 33 (12), 2944–2952. 10.1021/acs.chemrestox.0c00202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (35).Ma F; Yan S; Zhang J; Wang Y; Wang L; Wang Y; Zhang S; Du X; Zhang P; Chen H-Y; Huang S Nanopore Sequencing Accurately Identifies the Cisplatin Adduct on DNA. ACS Sens. 2021, 6 (8), 3082–3092. 10.1021/acssensors.1c01212. [DOI] [PubMed] [Google Scholar]
  • (36).Fleming AM; Mathewson NJ; Howpay Manage SA; Burrows CJ Nanopore Dwell Time Analysis Permits Sequencing and Conformational Assignment of Pseudouridine in SARS-CoV-2. ACS Cent. Sci 2021, 7 (10), 1707–1717. 10.1021/acscentsci.1c00788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (37).Tavakoli S; Nabizadeh M; Makhamreh A; Gamper H; McCormick CA; Rezapour NK; Hou Y-M; Wanunu M; Rouhanifard SH Semi-Quantitative Detection of Pseudouridine Modifications and Type I/II Hypermodifications in Human MRNAs Using Direct Long-Read Sequencing. Nature Communications 2023, 14 (1), 334. 10.1038/s41467-023-35858-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (38).Brinkerhoff H; Kang ASW; Liu J; Aksimentiev A; Dekker C Multiple Rereads of Single Proteins at Single–Amino Acid Resolution Using Nanopores. Science 2021, 374 (6574), 1509–1513. 10.1126/science.abl4381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (39).Yan S; Zhang J; Wang Y; Guo W; Zhang S; Liu Y; Cao J; Wang Y; Wang L; Ma F; Zhang P; Chen H-Y; Huang S Single Molecule Ratcheting Motion of Peptides in a Mycobacterium Smegmatis Porin A (MspA) Nanopore. Nano Lett. 2021, 21 (15), 6703–6710. 10.1021/acs.nanolett.1c02371. [DOI] [PubMed] [Google Scholar]
  • (40).Ledbetter MP; Craig JM; Karadeema RJ; Noakes MT; Kim HC; Abell SJ; Huang JR; Anderson BA; Krishnamurthy R; Gundlach JH; Romesberg FE Nanopore Sequencing of an Expanded Genetic Alphabet Reveals High-Fidelity Replication of a Predominantly Hydrophobic Unnatural Base Pair. J. Am. Chem. Soc 2020, 142 (5), 2110–2114. 10.1021/jacs.9b09808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (41).Craig JM; Laszlo AH; Derrington IM; Ross BC; Brinkerhoff H; Nova IC; Doering K; Tickman BI; Svet MT; Gundlach JH Direct Detection of Unnatural DNA Nucleotides DNaM and D5SICS Using the MspA Nanopore. PLOS ONE 2015, 10 (11), e0143253. 10.1371/journal.pone.0143253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (42).de Souza FAL; Sivaraman G; Fyta M; Scheicher RH; Scopel WL; Amorim RG Electrically Sensing Hachimoji DNA Nucleotides through a Hybrid Graphene/h-BN Nanopore. Nanoscale 2020, 12 (35), 18289–18295. 10.1039/D0NR04363J. [DOI] [PubMed] [Google Scholar]
  • (43).Cherf GM; Lieberman KR; Rashid H; Lam CE; Karplus K; Akeson M Automated Forward and Reverse Ratcheting of DNA in a Nanopore at 5-Å Precision. Nature Biotechnology 2012, 30 (4), 344–348. 10.1038/nbt.2147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (44).Kasianowicz JJ; Brandin E; Branton D; Deamer DW Characterization of Individual Polynucleotide Molecules Using a Membrane Channel. Proceedings of the National Academy of Sciences 1996, 93 (24), 13770–13773. 10.1073/pnas.93.24.13770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (45).Laszlo AH; Derrington IM; Ross BC; Brinkerhoff H; Adey A; Nova IC; Craig JM; Langford KW; Samson JM; Daza R; Doering K; Shendure J; Gundlach JH Decoding Long Nanopore Sequencing Reads of Natural DNA. Nature Biotechnology 2014, 32 (8), 829–833. 10.1038/nbt.2950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (46).Noakes MT; Brinkerhoff H; Laszlo AH; Derrington IM; Langford KW; Mount JW; Bowman JL; Baker KS; Doering KM; Tickman BI; Gundlach JH Increasing the Accuracy of Nanopore DNA Sequencing Using a Time-Varying Cross Membrane Voltage. Nature Biotechnology 2019, 37 (6), 651–656. 10.1038/s41587-019-0096-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (47).Derrington IM; Craig JM; Stava E; Laszlo AH; Ross BC; Brinkerhoff H; Nova IC; Doering K; Tickman BI; Ronaghi M; Mandell JG; Gunderson KL; Gundlach JH Subangstrom Single-Molecule Measurements of Motor Proteins Using a Nanopore. Nature Biotechnology 2015, 33 (10), 1073–1075. 10.1038/nbt.3357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (48).Craig JM; Laszlo AH; Brinkerhoff H; Derrington IM; Noakes MT; Nova IC; Tickman BI; Doering K; de Leeuw NF; Gundlach JH Revealing Dynamics of Helicase Translocation on Single-Stranded DNA Using High-Resolution Nanopore Tweezers. Proc Natl Acad Sci USA 2017, 114 (45), 11932–11937. 10.1073/pnas.1711282114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (49).Wang Y; Zhao Y; Bollas A; Wang Y; Au KF Nanopore Sequencing Technology, Bioinformatics and Applications. Nature Biotechnology 2021, 39 (11), 1348–1365. 10.1038/s41587-021-01108-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (50).Laszlo AH; Derrington IM; Gundlach JH MspA Nanopore as a Single-Molecule Tool: From Sequencing to SPRNT. Methods 2016, 105, 75–89. 10.1016/j.ymeth.2016.03.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (51).Butler TZ; Pavlenok M; Derrington IM; Niederweis M; Gundlach JH Single-Molecule DNA Detection with an Engineered MspA Protein Nanopore. Proc Natl Acad Sci USA 2008, 105 (52), 20647–20652. 10.1073/pnas.0807514106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (52).LaMont CH; Wiggins PA The Development of an Information Criterion for Change-Point Analysis. Neural Computation 2016, 28 (3), 594–612. 10.1162/NECO_a_00809. [DOI] [PubMed] [Google Scholar]
  • (53).Craig JM; Laszlo AH; Nova IC; Brinkerhoff H; Noakes MT; Baker KS; Bowman JL; Higinbotham HR; Mount JW; Gundlach JH Determining the Effects of DNA Sequence on Hel308 Helicase Translocation along Single-Stranded DNA Using Nanopore Tweezers. Nucleic Acids Research 2019, 47 (5), 2506–2513. 10.1093/nar/gkz004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (54).Seela F; Wei C; Melenewski A Isoguanine Quartets Formed by d(T4isoG4T4): Tetraplex Identification and Stability. Nucleic Acids Research 1996, 24 (24), 4940–4945. 10.1093/nar/24.24.4940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (55).Chaput JC; Switzer C A DNA Pentaplex Incorporating Nucleobase Quintets. Proceedings of the National Academy of Sciences 1999, 96 (19), 10614–10619. 10.1073/pnas.96.19.10614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (56).Bezrukov SM; Kasianowicz JJ Current Noise Reveals Protonation Kinetics and Number of Ionizable Sites in an Open Protein Ion Channel. Phys. Rev. Lett 1993, 70 (15), 2352–2355. 10.1103/PhysRevLett.70.2352. [DOI] [PubMed] [Google Scholar]
  • (57).Laszlo AH; Craig JM; Gavrilov M; Tippana R; Nova IC; Huang JR; Kim HC; Abell SJ; deCampos-Stairiker M; Mount JW; Bowman JL; Baker KS; Higinbotham H; Bobrovnikov D; Ha T; Gundlach JH Sequence-Dependent Mechanochemical Coupling of Helicase Translocation and Unwinding at Single-Nucleotide Resolution. Proceedings of the National Academy of Sciences 2022, 119 (36), e2202489119. 10.1073/pnas.2202489119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (58).Craig JM; Mills M; Kim HC; Huang JR; Abell SJ; Mount JW; Gundlach JH; Neuman KC; Laszlo AH Nanopore Tweezers Measurements of RecQ Conformational Changes Reveal the Energy Landscape of Helicase Motion. Nucleic Acids Research 2022, 50 (18), 10601–10613. 10.1093/nar/gkac837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (59).Büttner K; Nehring S; Hopfner K-P Structural Basis for DNA Duplex Separation by a Superfamily-2 Helicase. Nature Structural & Molecular Biology 2007, 14 (7), 647–652. 10.1038/nsmb1246. [DOI] [PubMed] [Google Scholar]
  • (60).Li M-Y; Ying Y-L; Yu J; Liu S-C; Wang Y-Q; Li S; Long Y-T Revisiting the Origin of Nanopore Current Blockage for Volume Difference Sensing at the Atomic Level. JACS Au 2021, 1 (7), 967–976. 10.1021/jacsau.1c00109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (61).Davis DR Stabilization of RNA Stacking by Pseudouridine. Nucleic Acids Research 1995, 23 (24), 5020–5026. 10.1093/nar/23.24.5020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (62).Saenger W; Hunter WN; Kennard O DNA Conformation Is Determined by Economics in the Hydration of Phosphate Groups. Nature 1986, 324 (6095), 385–388. 10.1038/324385a0. [DOI] [PubMed] [Google Scholar]
  • (63).Rich A The Double Helix: A Tale of Two Puckers. Nature Structural & Molecular Biology 2003, 10 (4), 247–249. 10.1038/nsb0403-247. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Info
NIHMS2038363-supplement-Supplementary_Info.pdf (5.9MB, pdf)

Data Availability Statement

The data underlying this article are available in figshare and can be accessed with https://figshare.com/s/1a23062119aa22f33de2.

RESOURCES