Skip to main content
NCBI home page
Cellular and Molecular Neurobiology logoLink to Cellular and Molecular Neurobiology
. 2008 Aug 26;29(1):87–95. doi: 10.1007/s10571-008-9300-3

Hemolysate-induced Expression of Intercellular Adhesion Molecule-1 and Monocyte Chemoattractant Protein-1 Expression in Cultured Brain Microvascular Endothelial Cells via Through ROS-dependent NF-κB Pathways

Hua Lu 1, Ji-Xin Shi 1,✉, Dong-Mei Zhang 2, Jie Shen 2, Yi-Xing Lin 1, Chun-Hua Hang 1, Hong-Xia Yin 1
PMCID: PMC11506154  PMID: 18726687

Abstract

In order to determine the possible effects of hemolysate on brain microvascular endothelial cells (BMECs), we examined the effects of hemolysate on the expression of intercellular adhesion molecule-1 (ICAM-1) and monocyte chemoattractant protein-1 (MCP-1), generation of reactive oxygen species (ROS), and NF-κB activation in rat BMECs. Hemolysate induced the expression of ICAM-1 and MCP-1 in endothelial cells. In addition, hemolysate stimulated nuclear translocation of the p65 subunit of NF-κB, and NF-κB DNA-binding activity in BMECs. Furthermore, hemolysate increased ROS generation, and hemolysate-induced ICAM-1and MCP-1 expression and NF-κB activation were abrogated in the presence of the direct scavenger of ROS. Taken together, our results indicate that hemolysate can induce inflammatory responses that increase expression of ICAM-1 and MCP-1, through ROS-dependent NF-κB activation in BMECs.

Keywords: Brain microvascular endothelial cells, Hemolysate, Inflammation, Intercellular adhesion molecule-1, Monocyte chemoattractant protein-1, NF-κB, Reactive oxygen species

Introduction

Cerebral vasospasm after subarachnoid hemorrhage (SAH) is a major clinical problem causing cerebral ischemia and infarction. Cerebrovascular inflammation that plays a key role in cerebral vasospasm contributes to secondary brain injury following SAH. The inflammatory reaction involves complex interactions between inflammatory cells (neutrophils, lymphocytes, and monocytes/macrophages) and vascular cells (endothelial cells and smooth muscle cells). Brain microvascular endothelial cells (BMECs) not only release vasoactive factors and messenger molecules that play key roles in the regulation of cerebral blood flow, but also regulate the inflammatory process through the expression of adhesion molecules, chemokines, and growth factors (Tedgui and Mallat 2001). Intercellular adhesion molecule-1 (ICAM-1) and monocyte chemoattractant protein-1 (MCP-1) play critical roles in mediating monocyte adhesion and migration to the vascular endothelium (Dzenko et al. 2005; Gallia and Tamargo 2006). Activation of the endothelium at the sites of inflammation allows macrophages and neutrophils to attach and then pass through the vascular wall. Tissue leukocytes and BMECs may continue to release cytokines, including ICAM-1, MCP-1, and other factors that propagate the inflammatory process often leading to bouts of inflammation (Song and Pachter 2004; Zhang et al. 2006).

Reactive oxygen species (ROS) are formed as a result of physiologic cellular metabolism and although they are essential for signalization and they also, when produced in excess, contribute to the pathogenesis of many diseases. Involvement of oxidative stress in the development of SAH was suggested by demonstrating the presence of increased protein and lipid peroxidation in the brain and cerebrospinal fluid (Liu et al. 2007; Clark et al. 2008). Previous results demonstrated that hemolysate has been shown to induce oxidative stress directly and indirectly (Yoshida et al. 1994; Matz et al. 2000). These data indicate that increased levels of ROS in the brain can induce neuronal damage. ROS can also act as second messengers in the intracellular signaling pathways involved in the expression of many cellular genes such as ICAM-1 and MCP-1 (Kim 2007a; Sharma et al. 2008).

Further understanding of the role of ROS generation in BMECs induced by hemolysate might help to develop a therapeutic tool for SAH. The possible roles of ROS involved in hemolysate-induced ICAM-1 and MCP-1 expression have not been studied. In this article, we examined the molecular mechanism responsible for hemolysate-induced expression of ICAM-1 and MCP-1. We show that hemolysate increased the intracellular level of ROS, which is involved in the translocation of NF-κB and subsequent expression of ICAM-1 and MCP-1 in BMECs.

Materials and Methods

Reagents

N-acetyl-l-cysteine (NAC), N-p-tosyl-l-lysine chloromethyl ketone hydrochloride (TLCK), vitamin C (VitC), 2′7′-dichlorofluorescin diacetate (DCFHDA) and BAY 11-7082 were obtained from Sigma. Monoclonal anti-ICAM-1, monoclonal anti-MCP-1, and polyclonal anti-NF-κB p65antibodies were obtained from Santa Cruz Biotechnology. Dulbecco’s modified Eagle medium (DMEM) was purchased from Gibco. Fetal calf serum and penicillin/streptomycin were purchased from Sunshine biocompany (China). ROS reagent kits were supplied by Nanjing Jiancheng Bioengineering Institute (China).

Isolation of BMECs

Primary cultures of BMECs from newborn SD rat were established as described previously (Yakubu and Leffler 1999, 2005). In brief, rats were decapitated and the meninges removed. Under sterile conditions, cerebral cortices were isolated and minced in a medium containing DMEM, 100 U/ml penicillin and 100 mg/ml streptomycin. After a rinse with medium, the tissue was homogenized and serially passed through nylon meshes of 149 and 74 mm. The tissue retained by the 74-mm meshes was digested at collagenase-Dispase solution (1 mg/ml) for 2 h at 37°C. At the end of the incubation, the dispersed microvascular endothelial cells were separated using Percoll density gradient centrifugation. Endothelial cells were resuspended in culture medium consisting of 20% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin. Twenty-four hours after plating, adherent cells were washed and fed fresh medium. The culture medium was changed every 2–3 days until cells attained confluence and maintained in a 5% CO2–95% air incubator at 37°C. Confluent cells were starved overnight with 1% FBS-conditioned media and used for the experiments. Cultures were used at 15–17 days in vitro and verified to be 95% VIII positive by immunostaining.

Preparation of Hemolysate

Hemolysate was prepared as previously described (Iwabuchi et al. 1999). Briefly, heparinized rats’ arterial blood was centrifuged at 2,500g for 15 min at 4°C, and the supernatant was aspirated. The erythrocyte-rich precipitate was washed with cold saline solution lysed by a freeze-thaw procedure. The membrane debris was pelleted by centrifugation at 31,000g for 15 min and the erythrocyte lysate was stored at −80°C. The concentration of hemolysate was determined by measuring hemoglobin spectrophotometrically. Two absorbance peaks at 540 and 576 nm were observed in the hemolysate sample, confirming the presence of oxyhemoglobin (OxyHb). The concentration of OxyHb in the preparation of 100% hemolysate was 10.92 mM. In this article, treatment with hemolysate at a concentration of 10 vol.% was added to cell media.

Real-time RT-PCR

Expression of the ICAM-1 and MCP-1 gene in BMECs was investigated at the mRNA level by real-time RT-PCR. Total RNA from BMECs was isolated a TRIzol reagent kit (Invitrogen), according to the manufacturer’s instructions. cDNA synthesis was performed on 3 μg of total RNA with a reverse transcription kit (Promega). Real-time PCR quantification was performed using a SYBR Green approach (Molecular Probes) in Rotor-Gene 3000 real-time sequence detection system (Corbett Research) as outlined in Table 1. Relative quantitation of gene expression was assessed by the relative standard curve method using a serial dilution of cDNA samples. The entire cycling process was monitored using the Rotor-gene real-time software 6.0 (Corbett Research).

Table 1.

Primers sequence and reaction parameters used in real-time PCR

Gene Forward primer Reverse primer T (°C) Product length (bp)
MCP-1 CCCAGAAACCAGCCAACT TGCTGCTGGTGATTCTCTTG 61 223
ICAM-1 AGCTCTTCAAGCTGAGCGACAT ACTCGCTCTGGGAACGAATACA 61 118
β-actin CCTCTATGCCAACACAGTGC GTACTCCTGCTTGCTGATCC3 58 211
Open in a new tab

T, annealing temperature

Western Blot Analysis

Culture medium was removed and washed twice with chilled (4°C) PBS. The cells were quickly scraped and collected by centrifugation and then stored at −80°C until they were assayed. Cells were lysed in 20 mM Tris–HCl (pH 8.0), 4 M NaCl, 0.5 M EDTA. Protein concentration in the supernatant was determined by the Bradford assay (Bio-Rad). Equal amounts of protein extracts were then electrophoresed on SDS–PAGE, transferred to nitrocellulose membrane. The blots were blocked with in 3% (wt/vol) low-fat milk. Membranes were immunoblotted with a primary anti-ICAM-1 rabbit monoclonal antibody (1:1,000 dilution), or with anti-MCP-1 (1:600 dilution), or anti-GAPDH antibodies (1:1,000 dilution), or Lamin B antibodies (1:1,000 dilution) followed by secondary horseradish-peroxidase-conjugated antibody. Blots were then incubated with secondary antibody conjugated to horseradish peroxidase and visualized with an enhanced chemiluminescent method kit (Wuhan Boster Biological Technology Ltd., Wuhan, China).

Nuclear Protein Extraction

Nuclear protein extracts from BMECs to assay the nuclear translocation of NF-κB were prepared. Nuclear extracts of cells were prepared by hypotonic lyses followed by high salt extraction. In brief, cells were homogenized in 0.8 ml ice-cold buffer A, composed of 10 mmol/l HEPES (pH 7.9), 10 mmol/l KCl, 2 mmol/l MgCl2, 0.1 mmol/l EDTA, 1.0 mmol/l dithiothreitol (DTT), and 0.5 mmol/l phenylmethylsulfonyl fluoride (PMSF). The homogenate was incubated on ice for 10 min, and then 50 μl of 10% Nonidet P-40 solution was added; the mixture was vortexed for 30 s and spun by centrifugation for 1 min at 5,000g. The crude nuclear pellet was resuspended in 200 μl of buffer B, containing 20 mmol/l HEPES (pH 7.9), 420 mmol/l NaCl, 1.5 mmol/l MgCl2, 0.1 mmol/l EDTA, 1 mmol/l DTT, 0.5 mmol/l PMSF, 250 ml/l glycerol, and incubated on ice for 30 min with intermittent mixing. The suspension was spun by centrifugation at 12,000g for 10 min. The supernatant containing nuclear proteins was collected and stored at −70°C for further analysis. Protein concentration was determined using a bicinchoninic acid assay kit with bovine serum albumin as the standard (Pierce Biochemicals, Rockford, IL, USA). For the determination of NF-κB localization, Western blot analysis was carried out with nuclear protein extracts using anti-human NF-κB primary antibody (1:1,000). The Western blot analytical procedures were described above.

Electrophoretic Mobility Shift Assays

Electrophoretic mobility shift assays (EMSA) were performed using a commercial kit (Gel Shift Assay System, Promega, Madison, WI, USA). NF-κB consensus oligonucleotide probe (5′-AGTTGAG GGGACTTTCC CAGGC-3′) was end-labeled with [γ-32P] ATP (Free Biotech, Beijing, China) and T4-polynucleotide kinase. Nuclear protein (20 μg) was pre-incubated in a total volume of 9 μl in a binding buffer, consisting of 10 mmol/l Tris–Cl, pH 7.5, 1 mmol/l MgCl2, 50 mmol/l NaCl, 0.5 mmol/l EDTA, 0.5 mmol/l DTT, 4% glycerol, and 0.05 g/l of polydeoxyinosinic deoxycytidylic acid (dI-dC) for 15 min at room temperature. After addition of the 32P-labeled oligonucleotide probe, the incubation was continued for 20 min at room temperature. Reaction was stopped by the addition of 1 μl of gel loading buffer and the mixture was subjected to non-denaturing 4% polyacrylamide gel electrophoresis in a Tris-borate-EDTA buffer. The gel was vacuum-dried and exposed to X-ray (Fuji Hyperfilm) at −70°C till an intensifying screen.

Determination of Intracellular ROS

ROS production was measured in cytosolic fractions using 2′7′-DCFHDA as a probe. DCFHDA is a stable, non-fluorescent molecule that readily crosses the cell membrane and is hydrolyzed by intracellular esterases to non-fluorescent 2′,7′-dichlorofluorescein (DCFH), which is rapidly oxidized, in the presence of peroxides, to highly fluorescent 2′,7′-dichlorofluorescein (DCF). The DCF is then measured fluorimetrically. BMECs (1 × 105 cells) were maintained in serum-free media for 16 h, and then treated with hemolysate (10%) for varying time periods (0.5–24 h). In order to investigate the effect of NAC and VitC on hemolysate-induced ROS production, BMECs were incubated in the absence or presence of these inhibitors for 1 h, and then treated with hemolysate (10%) for 1 h. Cells were washed twice with PBS and incubated with DCF-DA (10 μM) for 30 min. The fluorescence was measured for all the plates using a fluorimeter (Safire, TECAN) at an absorption wavelength of 485 nm and emission wavelength of 520 nm. The results were expressed as relative fluorescence, normalized to control cell (no hemolysate stimuli).

Statistics

All data are presented in the statistics of three independent experiments in the form of mean ± SD. The significance of the difference was analyzed by Student–Newman–Keuls test. P-values <0.05 were considered statistically significant.

Results

Hemolysate Increases ICAM-1 and MCP-1 Expression in BMECs

Cytokines, such as ICAM-1 and MCP-1, on endothelial cells mediate monocyte adhesion and migration to the endothelium during inflammation. Therefore, we investigated whether hemolysate could induce the expression of ICAM-1 and MCP-1 on endothelial cells. A significant increase in ICAM-1 and MCP-1 expression was noted after cells treated for 2 h with 10% hemolysate, and reached highest point at 24 h. Treatment of BMECs with 10% hemolysate increased the ICAM-1 and MCP-1 protein levels in time-dependent manner (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Induction of ICAM-1 and MCP-1 protein expression in BMECs by hemolysate. BMECs were treated with 10% hemolysate for varying times. Cell extracts were prepared and analyzed for ICAM-1 and MCP-1 protein expression. GAPDH protein was used as an internal control

Hemolysate Activates Transcription of ICAM-1 and MCP-1 Gene in BMECs

In order to examine whether hemolysate activates transcription of ICAM-1 and MCP-1 in BMECs, we analyzed the induction of ICAM-1 and MCP-1 mRNA expression in hemolysate-treated BMECs (Fig. 2). Cells were treated with hemolysate and mRNA levels of ICAM-1 and MCP-1 were measured by real-time RT-PCR. As shown in Fig. 2, increase in levels of ICAM-1 and MCP-1 mRNA was observed in BMECs following hemolysate treatment.

Fig. 2.

Fig. 2

Open in a new tab

Effects of hemolysate on VCAM-1 and MCP-1 mRNA expression in BMECs. BMEC confluent monolayers were grown in 35-mm dishes and stimulated with hemolysate for different periods of time (0–24 h). mRNA expression for VCAM-1, MCP-1, and GAPDH genes in BMECs was assessed by real-time PCR. In order to quantify VCAM-1 and MCP-1 gene expression, the VCAM-1 and MCP-1 mRNA levels were normalized by the total RNA content (μg/μl) and GAPDH mRNA level. Results were expressed as a fold induction respect time 0. Means and SD of at least three experiments are shown. * P < 0.05, when compared to time 0

NF-κB is Responsible for Induction of ICAM-1 and MCP-1 Expression by Hemolysate in BMECs

ICAM-1 and MCP-1 expression is regulated by different transcription factors including NF-κB in BMECs (Kim et al. 2007b). Our previous studies demonstrated that hemolysate is associated with an increase in NF-κB-binding activity in vascular smooth muscle cells (Zhou et al. 2007). In order to examine the involvement of NF-κB in ICAM-1 and MCP-1 expression, BMECs were treated with hemolysate, and the translocation of NF-κB was measured by Western blot. Nuclear accumulation of NF-κB p65 in hemolysate-treated BMECs was strongly induced. Pharmacological NF-κB inhibitors, TLCK, and BAY 11-7082, prevented hemolysate-induced translocation of p65 (Fig. 3a). In addition, pretreatment with TLCK, or BAY 11-7082, suppressed hemolysate-induced expression of ICAM-1 and MCP-1 protein (Fig. 3b). These results indicate that hemolysate-induced NF-κB activity is necessary for inducing ICAM-1 and MCP-1 expression in BMECs.

Fig. 3.

Fig. 3

Open in a new tab

NF-κB dependency of ICAM-1 and MCP-1 expression in BMECs induced by hemolysate. Cells were treated with 10% hemolysate for 1 h with or without pretreatment with NF-κB inhibitors (100 μM TLCK, 1 μM BAY 11-7082) for 1 h. Nuclear extracts were prepared from the BMECs treated with hemolysate and the levels of p65 were determined by Western blot analysis (a). BMECs were treated with 10% hemolysate for 12 h with or without pretreatment with NF-κB inhibitors (100 μM TLCK, 1 μM BAY 11-7082) for 1 h. Cell extracts were prepared and analyzed for ICAM-1 and MCP-1 protein expression (b)

Generation of ROS by Hemolysate in BMECs

Since NF-κB is one of redox-dependent transcription factors (Hirota et al. 2001), ROS may be involved in hemolysate-induced increase of ICAM-1 and MCP-1 expression by BMECs. We examined whether ROS can be generated in BMECs treated with hemolysate. After treatment with hemolysate for various time periods, cells were incubated with DCFHDA, which has been used as a general marker of intracellular ROS production. As shown in Fig. 4a, increase in ROS levels was observed in BMECs. ROS production was detected as early as 0.5 h and was maximal at 1 h after treatment with hemolysate. To further characterize hemolysate-induced ROS production in BMECs, we utilized antioxidants, NAC, and VitC. Pretreatment with NAC and VitC inhibited hemolysate-induced increase of intracellular ROS levels in BMECs (Fig. 4b). These results indicate that hemolysate induces generation of ROS in BMECs.

Fig. 4.

Fig. 4

Open in a new tab

Analysis of ROS generation in the BMECs exposed to hemolysate. Cells were treated with 10% hemolysate for various times and intracellular ROS levels were measured after staining with DCFHDA. Cells were not treated as control (a). To analyze the effect of NAC and VitC on hemolysate-induced ROS production, BMECs were pretreated with NAC (100 μM), or VitC (10 μM) for 30 m and incubated with 10% hemolysate for 1 h and then intracellular ROS were measured (b). * P < 0.05, when compared to control (a); * P < 0.05 when compared to hemolysate (b)

Hemolysate-induced ICAM-1 and MCP-1 Expression and NF-κB Activation are Associated with ROS Production

Next, we examined the possible role of ROS in hemolysate-induced nuclear translocation and DNA binding ability of NF-κB in BMECs. Cells were incubated in the absence or presence of NAC, or VitC for 30 min, followed by exposure to 10% hemolysate for 1 h. The nuclear translocation of NF-κB was analyzed by Western blot. In addition, nuclear extracts were used for EMSA with a radioactive labeled NF-κB probe. As an indicator of NF-κB activation, p65 subunit was chosen and analyzed in by Western blot analysis. As shown in Fig. 5, pretreatment with NAC and VitC suppressed hemolysate-induced nuclear translocation (Fig. 5a) as well as DNA binding activity (Fig. 5b) of NF-κB. We further used these inhibitors to analyze the role of ROS on hemolysate-induced up-regulation of ICAM-1 and MCP-1 expression in BMECs. Cells were incubated in the absence or presence of NAC or VitC for 30 min, treated with 10% hemolysate for, and then ICAM-1 and MCP-1 expression was analyzed by real-time RT-PCR and Western blot analysis. Pretreatment with NAC or VitC inhibited markedly ICAM-1 and MCP-1 mRNA (Fig. 6a) and protein (Fig. 6b) expression.

Fig. 5.

Fig. 5

Open in a new tab

Effect of antioxidants on the NF-κB nuclear localization and DNA-binding activity in BMECs cells exposed to hemolysate. Cells were treated with 10% hemolysate for 1 h with or without pretreatment with the various antioxidants (100 μM NAC, 10 μM VitC). Nuclear extracts were prepared from the BMECs treated with hemolysate and the levels of p65 were determined by Western blot analysis (a). DNA-binding activity of NF-κB in the nuclear extracts of the BMECs s was measured by EMSA (b)

Fig. 6.

Fig. 6

Open in a new tab

Effects of antioxidants on hemolysate-induced ICAM-1 and MCP-1 expression in BMECs. (a) BMECs were treated with 100 μM NAC or 10 μM VitC for 30 min, then treated with 10% hemolysate for 8 h. Total RNA was extracted. ICAM-1, MCP-1, and GAPDH mRNA were analyzed by real-time RT-PCR using specific primers. (b) BMECs were treated with 10% hemolysate for 12 h with or without pretreatment with various antioxidants for 30 min. Cell extracts were prepared and analyzed for ICAM-1 and MCP-1 protein expression. * P < 0.05, when compared to hemolysate

Discussion

This article supports and extends this concept that hemolysate induces ICAM-1 and MCP-1 expression through ROS-dependent NF-κB activation in BMECs on the basis of the following evidence: (1) hemolysate induced the expression of ICAM-1 and MCP-1; (2) hemolysate-induced ICAM-1 and MCP-1 expression required the activation of NF-κB; and (3) ROS were responsible for both hemolysate-induced ICAM-1 and MCP-1 expression and hemolysate-stimulated activation of NF-κB.

Adhesion of circulating monocytes to the endothelium and their subsequent migration into the vascular wall are critical steps in vascular inflammatory responses. The binding of monocytes to the vascular endothelium is mediated by cross-linkage of cell adhesion molecules, such as ICAM-1, and the cell surface expression of this molecule is greatly increased at sites of endothelium, reflecting the localized pro-inflammatory environment (Blankenberg et al. 2003). Once the monocyte is tightly bound, it then migrates between endothelial cells in response to the chemokine MCP-1 (Charo and Taubman 2004). The hemolysate role in the development of SAH is not fully understood. Increasing evidence suggests that inflammation and immunity are involved in all stages of SAH (Provencio and Vora 2005). BMECs can be induced by hemolysate as well as various proinflammatory cytokines such as TNF-α to express the ICAM-1 and MCP-1 (Otto et al. 2000; Harkness et al. 2003). Enhanced expression of ICAM-1 and MCP-1 in BMECs is required for monocyte–endothelial interaction, which increases infiltration and migration of monocytes into the central nerve system (Ancuta et al. 2004). In this article, we found increased ICAM-1 and MCP-1 expression from hemolysate-induced BMECs, which suggest that in response to hemolysate, BMECs increase in functional potentiation. Of course, further studies are necessary to clarify the inflammatory effect of hemolysate and its underlying molecular mechanism in the hemorrhagic stroke.

The NF-κB pathway is important for the expression of a wide variety of genes involved in the control of the inflammatory responses, including increasing the adhesion and migration of lymphocytes (Barnes and Karin 1997; Vanden Berghe et al. 2003). Pro-inflammatory cytokines, oxygen-free radicals, and other stress signals activate the inhibitor of the NF-κB kinase complex, which phosphorylates the IκBs, causing the release of NF-κB proteins from NF-κB–IκB complexes and translocation to the nucleus (Peng 2004). ICAM-1 and MCP-1 are regulated primarily at the level of gene transcription upon a variety of stimuli. In this article, we showed that hemolysate-induced increase in ICAM-1 and MCP-1 expression is regulated at the transcriptional level in an NF-κB-dependent pathway. NF-κB inhibitors inhibited the expression of ICAM-1 and MCP-1 gene in response to hemolysate via suppressing NF-κB activation, suggesting the functional relevance of hemolysate-mediated activation of NF-κB.

Oxidative stress is an important determinant of endothelial dysfunction and vascular injury (Lum and Roebuck 2001). We performed experiments to explore the mechanisms of NF-κB activation by hemolysate. As shown in Fig. 4, ROS generation was induced following hemolysate treatment of BMECs. ROS influence a number of cellular responses by turning on several intracellular signaling cascades in vascular cells, which contribute to altered vascular tone, vascular inflammation, and vascular remodeling, thus leading to the progression of vascular diseases (Fortuño et al. 2005). Hemolysate-induced NF-κB p65 translocation and NF-κB binding was significantly inhibited in the cells treated with hemolysate in the presence of antioxidants, indicating that hemolysate-mediated ROS generation was associated with activation of NF-κB in BMECs. The functional role of ROS generation by hemolysate was demonstrated by our results showing that up-regulation of mRNA and protein expression of ICAM-1 and MCP-1 diminished in the BMECs treated with antioxidants. The exact mechanism by which hemolysate induces the generation of ROS in BMECs is not clear. Further study is required to define the source of ROS generation induced by hemolysate.

Precise understanding of pathophysiology and molecular actions of hemolysate will lead to the discovery of effective therapeutic intervention. Development of pharmacological hemolysate antagonists and novel manipulations which inhibit hemolysate signaling may be promising strategies to attenuate the proinflammatory effects of hemolysate on endothelial cells and ultimately to reduce the progression of hemorrhagic stroke.

In conclusion, this article demonstrated that hemolysate has direct proinflammatory effects on BMECs, which promote the expression of ICAM-1 and MCP-1 and through ROS-dependent NF-κB activation. Our findings provide a potential role for hemolysate in the pathogenesis of endothelial dysfunction. This knowledge may provide a rationale for the development of antioxidant compounds that may be useful as therapeutic agents for hemolysate-related vascular diseases.

Acknowledgment

This work was supported by a grant from the National Natural Science Foundation of China (no. 30700866).

References

  1. Ancuta P, Moses A, Gabuzda D (2004) Transendothelial migration of CD16+ monocytes in response to fractalkine under constitutive and inflammatory conditions. Immunobiology 209:11–20. doi:10.1016/j.imbio.2004.04.001 [DOI] [PubMed] [Google Scholar]
  2. Barnes PJ, Karin M (1997) Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 336:1066–1071. doi:10.1056/NEJM199704103361506 [DOI] [PubMed] [Google Scholar]
  3. Blankenberg S, Barbaux S, Tiret L (2003) Adhesion molecules and atherosclerosis. Atherosclerosis 170:191–203. doi:10.1016/S0021-9150(03)00097-2 [DOI] [PubMed] [Google Scholar]
  4. Charo IF, Taubman MB (2004) Chemokines in the pathogenesis of vascular disease. Circ Res 95:858–866. doi:10.1161/01.RES.0000146672.10582.17 [DOI] [PubMed] [Google Scholar]
  5. Clark JF, Loftspring M, Wurster WL, Pyne-Geithman GJ (2008) Chemical and biochemical oxidations in spinal fluid after subarachnoid hemorrhage. Front Biosci 13:1806–1812. doi:10.2741/2801 [DOI] [PubMed] [Google Scholar]
  6. Dzenko KA, Song L, Ge S, Kuziel WA, Pachter JS (2005) CCR2 expression by brain microvascular endothelial cells is critical for macrophage transendothelial migration in response to CCL2. Microvasc Res 70:53–64. doi:10.1016/j.mvr.2005.04.005 [DOI] [PubMed] [Google Scholar]
  7. Fortuño A, San José G, Moreno MU, Díez J, Zalba G (2005) Oxidative stress and vascular remodelling. Exp Physiol 90:457–462. doi:10.1113/expphysiol.2005.030098 [DOI] [PubMed] [Google Scholar]
  8. Gallia GL, Tamargo RJ (2006) Leukocyte-endothelial cell interactions in chronic vasospasm after subarachnoid hemorrhage. Neurol Res 28:750–758. doi:10.1179/016164106X152025 [DOI] [PubMed] [Google Scholar]
  9. Harkness KA, Sussman JD, Davies-Jones GA, Greenwood J, Woodroofe MN (2003) Cytokine regulation of MCP-1 expression in brain and retinal microvascular endothelial cells. J Neuroimmunol 142:1–9. doi:10.1016/S0165-5728(03)00251-0 [DOI] [PubMed] [Google Scholar]
  10. Hirota K, Murata M, Itoh T, Yodoi J, Fukuda K (2001) Redox-sensitive transactivation of epidermal growth factor receptor by tumor necrosis factor confers the NF-κB activation. J Biol Chem 276:25953–25958. doi:10.1074/jbc.M011021200 [DOI] [PubMed] [Google Scholar]
  11. Iwabuchi S, Marton LS, Zhang JH (1999) Role of protein tyrosine phosphorylation in erythrocyte lysate-induced intracellular free calcium concentration elevation in cerebral smooth-muscle cells. J Neurosurg 90:127–135 [DOI] [PubMed] [Google Scholar]
  12. Kim HJ, Park KG, Yoo EK, Kim YH, Kim YN, Kim HS et al (2007a) Effects of PGC-1alpha on TNF-alpha-induced MCP-1 and VCAM-1 expression and NF-kappaB activation in human aortic smooth muscle and endothelial cells. Antioxid Redox Signal 9:301–307. doi:10.1089/ars.2006.1456 [DOI] [PubMed] [Google Scholar]
  13. Kim YS, Ahn Y, Hong MH, Kim KH, Park HW, Hong YJ et al (2007b) Rosuvastatin suppresses the inflammatory responses through inhibition of c-Jun N-terminal kinase and nuclear factor-kappaB in endothelial cells. J Cardiovasc Pharmacol 49:376–383. doi:10.1097/FJC.0b013e31804a5e34 [DOI] [PubMed] [Google Scholar]
  14. Liu S, Tang J, Ostrowski RP, Titova E, Monroe C, Chen W et al (2007) Oxidative stress after subarachnoid hemorrhage in gp91phox knockout mice. Can J Neurol Sci 34:356–361 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lum H, Roebuck KA (2001) Oxidant stress and endothelial cell dysfunction. Am J Physiol Cell Physiol 280:719–741 [DOI] [PubMed] [Google Scholar]
  16. Matz PG, Copin JC, Chan PH (2000) Cell death after exposure to subarachnoid hemolysate correlates inversely with expression of CuZn-superoxide dismutase. Stroke 31:2450–2459 [DOI] [PubMed] [Google Scholar]
  17. Otto VI, Heinzel-Pleines UE, Gloor SM, Trentz O, Kossmann T, Morganti-Kossmann MC (2000) sICAM-1 and TNF-alpha induce MIP-2 with distinct kinetics in astrocytes and brain microvascular endothelial cells. J Neurosci Res 60:733–742. doi :10.1002/1097-4547(20000615)60:6<733::AID-JNR5>3.0.CO;2-X [DOI] [PubMed] [Google Scholar]
  18. Peng SL (2004) Transcription factors in the pathogenesis of autoimmunity. Clin Immunol 110:112–123. doi:10.1016/j.clim.2003.10.008 [DOI] [PubMed] [Google Scholar]
  19. Provencio JJ, Vora N (2005) Subarachnoid hemorrhage and inflammation: bench to bedside and back. Semin Neurol 25:435–444. doi:10.1055/s-2005-923537 [DOI] [PubMed] [Google Scholar]
  20. Sharma R, Traore K, Trush MA, Rose NR, Burek CL (2008) Intracellular adhesion molecule-1 up-regulation on thyrocytes by iodine of non-obese diabetic.H2(h4) mice is reactive oxygen species-dependent. Clin Exp Immunol 152:13–20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Song L, Pachter JS (2004) Monocyte chemoattractant protein-1 alters expression of tight junction-associated proteins in brain microvascular endothelial cells. Microvasc Res 67:78–89. doi:10.1016/j.mvr.2003.07.001 [DOI] [PubMed] [Google Scholar]
  22. Tedgui A, Mallat Z (2001) Anti-inflammatory mechanisms in the vascular wall. Circ Res 88:877–887. doi:10.1161/hh0901.090440 [DOI] [PubMed] [Google Scholar]
  23. Vanden Berghe W, Vermeulen L, Delerive P, De Bosscher K, Staels B, Haegeman G (2003) A paradigm for gene regulation: inflammation, NF-kappaB and PPAR. Adv Exp Med Biol 544:181–196 [DOI] [PubMed] [Google Scholar]
  24. Yakubu MA, Leffler CW (1999) Regulation of ET-1 biosynthesis in cerebral microvascular endothelial cells by vasoactive agents and PKC. Am J Physiol 276:300–305 [DOI] [PubMed] [Google Scholar]
  25. Yakubu MA, Leffler CW (2005) Regulation of cerebral microvascular endothelial cell cyclooxygenase-2 message and activity by blood derived vasoactive agents. Brain Res Bull 68:150–156. doi:10.1016/j.brainresbull.2005.07.020 [DOI] [PubMed] [Google Scholar]
  26. Yoshida Y, Kashiba K, Niki E (1994) Free radical-mediated oxidation of lipids induced by hemoglobin in aqueous dispersions. Biochim Biophys Acta 1201:165–172 [DOI] [PubMed] [Google Scholar]
  27. Zhang J, Rui YC, Yang PY, Lu L, Li TJ (2006) C-reactive protein induced expression of adhesion molecules in cultured cerebral microvascular endothelial cells. Life Sci 78:2983–2988. doi:10.1016/j.lfs.2005.11.027 [DOI] [PubMed] [Google Scholar]
  28. Zhou ML, Shi JX, Hang CH, Cheng HL, Qi XP, Mao L et al (2007) Potential contribution of nuclear factor-kappaB to cerebral vasospasm after experimental subarachnoid hemorrhage in rabbits. J Cereb Blood Flow Metab 27:1583–1592. doi:10.1038/sj.jcbfm.9600456 [DOI] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Neurobiology are provided here courtesy of Springer

RESOURCES