Skip to main content
NCBI home page
Cellular and Molecular Neurobiology logoLink to Cellular and Molecular Neurobiology
. 2008 Sep 19;29(2):181–192. doi: 10.1007/s10571-008-9309-7

Molecular Analysis of Endoplasmic Reticulum Stress Response After Global Forebrain Ischemia/Reperfusion in Rats: Effect of Neuroprotectant Simvastatin

P Urban 1, M Pavlíková 1, M Sivonová 1, P Kaplán 1, Z Tatarková 1, B Kaminska 2, J Lehotský 1,✉
PMCID: PMC11505799  PMID: 18807172

Abstract

Simvastatin is a cholesterol-lowering agent whose functional significance and neuroprotective mechanism in ischemic brain injury is not yet solved. The purpose of this study is to evaluate the effect of simvastatin on ischemic brain injury. We examined the endoplasmic reticulum stress response (UPR/unfolded protein response), by measuring the mRNA and protein levels of specific genes such as ATF6, GRP78, and XBP1 after 15 min 4-VO ischemia and different times of reperfusion (1, 3, and 24 h). The results from the group of naïve ischemic rats were compared with results from the group of pre-treated animals with simvastatin. The results of the experiments showed significant increase in all genes at the mRNA level in ischemic phase (about 43% for XBP1, 58% for GRP78, and 39% for ATF6 more than control). The protein level of XBP1 was decreased in pre-treated animals at ischemic phase and first hour of reperfusion (about 15% less), and did not reach control levels. The protein levels of GRP78 were maximal at third hour of reperfusion in statin group with a small decrease at 24 h of reperfusion in both groups. The levels of ATF6 mRNA in statin-treated animals was higher in comparison to non-statin animals at the ischemic phase and the third hour of reperfusion (about 35% higher), which was also translated into the higher protein level. This could indicate that one of the main proteins targeted to enhance neuroprotective effect to ER during the first two hours of reperfusion was ATF6 protein, the levels of which were 60% higher than in non-treated animals. These data suggest that simvastatin, in addition to the proposed neuroprotective effect, exerts a neuroprotective role in the attenuation of ER stress response after acute ischemic/reperfusion insult.

Keywords: Unfolded protein response, Global brain ischemia, Statins, Neuroprotective effect

Introduction

Neuronal ischemic/reperfusion damage in the brain occurs rapidly, however, significant structural changes are observed over a course of hours or days in the form of delayed neuronal death. Interruption of blood flow initiates high-energy metabolism failure, ATP depletion, ion imbalance, as well as other biochemical changes, such as an increase of free radicals, mitochondrial dysfunction, lactic acidosis, and inhibition of proteosynthesis as a consequence of endoplasmic reticular (ER) stress (DeGracia et al. 2002).

The endoplasmic reticulum of eukaryotic cell reacts to ischemic injury by the unfolded protein response (UPR), which can be highly variable, depending on dosage and duration of ischemic treatment (Imaizumi et al. 2001), and intensity of UPR signals (Yoshida et al. 2003). However, when ER stress is however too severe and prolonged, apoptosis is induced. Various enzymes and transcription factors including the double-stranded RNA-activated protein kinase (PKR)-like ERkinase (PERK (Harding et al. 1999), the transcription factors ATF4 and ATF6 (activating transcription factor 6) and the inositol-requiring enzyme IRE1 (Shen et al. 2001) are involved in the UPR. In the physiological state, PERK, ATF6, and IRE1 activity is suppressed by binding of the ER chaperone: glucose regulated protein 78 (GRP78). Morimoto et al. (2007) reported that induction of GRP78 prevents neuronal damage induced by ER stress, and the increase in GRP78 (BiP) expression may correlate with the degree of neuroprotection. Under ER dysfunction, GRP78 dissociates from PERK, ATF6, and IRE1 and binds to the unfolded proteins to facilitate refolding. Dissociation of GRP78 from PERK and IRE1 triggers activation of PERK and IRE1 and active ATF6 subsequently induces expression of ER stress genes. ATF6 is a key transcription factor in the resolution of the mammalian UPR, and unlike IRE1 and PERK, there is no evidence that ATF6 is involved in proapoptotic pathways (Yoshida et al. 2001); Haze et al. (1999) showed that ATF6 appears to be turned over fairly quickly; its half-life within the cell is 2 h. After being activated, IRE1 is turned into an endonuclease that specifically cuts out a sequence of 26 bases from the coding region of X-box protein 1 (XBP1) mRNA (Calfon et al. 2002). Processed XBP1 mRNA is translated into a new protein of 54 kDa that functions as a transcription factor specific for ER stress genes including GRP78 and GRP94. Paschen (2003b) have reported that XBP1 mRNA was induced at 6 h after cerebral ischemia and reperfusion.

Statins, inhibitors of sterol synthesis, have been shown to reduce cerebrovascular events by their pleiotropic effects independent of the cholesterol-lowering mechanism. Nagotani et al. (2005) found that simvastatin was the most effective statin against spontaneous stroke in human and animals. Strong liposolubility of statins may result in high permeability through the blood–brain barrier to the parenchyma, thereby protecting the neurons against ROS-induced lipid peroxidation and DNA oxidation. The neuroprotective properties of simvastatin in experimental stroke have been evaluated by using several rodent models of cerebral ischemia (Shabanzadeh et al. 2005; Hayashi et al. 2005).

As shown by previous studies, the changes of the UPR gene expression induced by transient ischemia occur mostly during the first 24 h (Paschen 2003b) or the first few days after the insult (Qi et al. 2004). In line with this, we have decided to measure changes in mRNA and protein levels of GRP78, ATF6, and XBP1 after 15 min of global ischemia and 1, 3, and 24 h reperfusion (UPR reaction). In addition, we have focused our attention on the effect of simvastatin pre-treatment on the stress reaction of endoplasmic reticulum induced by ischemic/reperfusion insult.

Material and Methods

Animal Model of Ischemia and Experimental Design

Adult male Wistar rats (mean body weight 320 g, total n = 60) used for the experiments were housed in a menagerie under standard conditions with a temperature of 22 ± 2°C, and periodical variation in day light at 12 h intervals. Food and water were provided ad libitum.

Global forebrain ischemia was induced by the standard four-vessel occlusion model (Lehotský et al. 2004; Sivonová et al. 2008; Uríková et al. 2006). Briefly, on day 1, both vertebral arteries were irreversibly occluded for 10 min by thermo coagulation through the alar foramina after anesthesia with 2,5% halothane in a mixture of oxygen/nitrous oxide (30%/70%), without any visible influence on the animals. On day 2, both common carotid arteries were occluded for 15 min by small atraumatic clips under anesthesia with 2,5% halothane in a mixture of oxygen/nitrous oxide (30%/70%). Two minutes before carotid occlusion, the halothane was removed from the mixture. Normothermic conditions (37°C) were monitored by a microthermistor placed in the ear. Temperature was maintained using a homeothermic blanket. Sham control animals (C, n = 6) were prepared in the same way without carotid occlusion. The rats then underwent 15 min ischemia (I, n = 6), followed by 1, 3, and 24 h of reperfusion (from I1R to I24R, respectively, each group n = 6). Criteria for forebrain ischemia were: Loss of the righting reflex, mydriasis, and paw extension. The rats that became unresponsive and lost the righting reflex during bilateral carotid artery occlusion and showed no seizures during and after ischemia were used for the experiment. Only such animals are considered to have met the criteria for adequate ischemia (Pulsinelli et al. 1982). All rats used reached the criteria for global forebrain ischemia. The animals for neuroprotection study were fed with simvastatin (20 mg/kg, medicament Simgal 40, Ivax Pharmaceuticals, Opava, Czech republic) during the two weeks prior to ischemia, with day-to-day control of empty bottles with dissolved simvastatin in 15 ml of water. Then, rats were divided into groups for the experiments mentioned above in the same way as non-treated animals (C, I, I1R-I24R, in each group n = 6). After decapitation whole brains were extracted in RNAase-free conditions, we isolated the cortexes and divided them into two hemispheres. The right hemispheres were used for Western blot analysis and left ones for mRNA analysis. All sections were weighed and stored at −80°C.

Real-Time Pcr

For maximal proof of changes in mRNA levels, we decided to use real-time PCR. We performed four analyses for each gene per animal (in each group n = 6). Total RNA was harvested by fenol–chloroform isolation using TRI reagent (Biotech). First-strand cDNA synthesis was performed using RevertAid H minus First strand cDNA Synthesis Kit (Fermentas Life sciences). Real-time PCR was made using primers:

Gene Forward primer sequence Reverse primer sequence
Xbp1 TGTCACCTCCCCAGAACATCT CAGGGTCCAACTTGTCCAGAA
Grp78 TGATAATCAGCCCACCGTAACA GGAGGGATTCCAGTCAGATCAA
Atf6 GGAAGTTACCAAGGCTTCTTTGAC TGGGTGGTAGCTGGTAATAGCA
18S AACGAACGAGACTCTGGCATG CGGACATCTAAGGGCATCACA
Open in a new tab

All fragments had 100 bp and the S18 was used as house-keeping gene. The PCR was conducted for 40 cycles (50°C for 2 min, 95°C for 10 min, and 95ºC for 15 s and 60ºC for 1 min) by 7500 Real-Time PCR System (Applied Biosystems). Each sample was loaded at least four times.

Western Blot Analysis

Cortexes from sham control, ischemic and simvastatin-treated animals were homogenized, and resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After Western blotting (Trans blot SD semi-dry transfer cell, Bio-rad) blots on nitrocellulose membrane were probed with goat polyclonal antibodies against GRP78 (sc-1051), XBP1 (sc-32138) and ATF6 (sc-30597, all from Santa Cruz Biotechnology) at room temperature for two hours in dilution 1:500. After being washed with 0.05% phosphate buffered saline (PBS)-Tween, the membranes were incubated with a donkey anti-goat secondary antibody conjugated with horseradish peroxidase (sc-2033, 1:3000, Santa Cruz Biotechnology) for 1 h and washed again with PBS-Tween. Finally, the membranes were developed with a SuperSignal West Pico Chemiluminescence Substrate (ECL system from Pierce, #34080) and detected by Molecular Imager Gel Doc XR System (Bio-Rad). Spot analysis was made using Gene Tools (SynGene). As housekeeper, we used ponceau staining (Fig. 1). We analyzed six animals per experimental group. To reduce differences among animals, sample loading on SDS–PAGE and variability due to ECL detection, Western blots were performed for each reperfusion time point per animal at least four times.

Fig. 1.

Fig. 1

Open in a new tab

Ponceau staining after Western blot (a) non-treated group of animals and (b) simvastatin pre-treated group of animals

Data Analysis

Data from naïve sham control, ischemic/reperfusion, and simvastatin-treated animals were examined by One-way ANOVA with Tukey’s post hoc test to analyze the significance of differences between groups (for either mRNA or protein levels). One-way ANOVA with the paired Student’s t-test was used to compare results between different times of reperfusion within the same experimental group (for either mRNA or protein levels). Data were presented as mean percent ± SD.

Results

In this study we have analyzed both the mRNA and the protein levels of ER stress genes after ischemic/reperfusion damage (I/R) in naive rats and rats pre-treated with simvastatin (20 mg/kg for 14 days).

XBP1

In the non-treated I/R animals, the mRNA level (Fig. 2) was significantly maximal in ischemic period (43 ± 3.2% in comparison to control), followed by rapid significant decrease from the first hour of reperfusion to a minimum value reached at the third hour (57 ± 7.8% lower than control). The mRNA level at 24 h of reperfusion reached control values.

Fig. 2.

Fig. 2

Open in a new tab

mRNA levels of XBP1 in rat forebrain after 15 min. ischemia and 1, 3, and 24 h reperfusion, comparison between groups with and without simvastatin pre-treatment, respectively. Results are presented as mean ± SEM for n = 6, normalized to control levels. * P < 0.05; *** P < 0.001 significantly different as compared to naïve and pre-treated controls, respectively. + P < 0.05 and 00 P < 0.01 mean significantly different between naïve ischemic and pre-treated animals in the same time points

The level of XBP1 protein in non-treated animals (Fig. 3) showed only slight, not significant, differences compared to controls, mainly at later reperfusion periods (3 and 24 h).

Fig. 3.

Fig. 3

Open in a new tab

Protein levels of XBP1 in rat forebrain after 15 min. ischemia and 1, 3, and 24 h reperfusion (a) comparison between groups with and without simvastatin pre-treatment, respectively. Results are presented as mean ± SEM for n = 6, normalized to control levels. ** P < 0.01 significantly different as compared to pre-treated control animals. +++, ### P < 0.001 mean significantly different between naïve ischemic and pre-treated animals in the same time points (b) detected bands for protein XBP1 in naïve ischemic animals. (c) detected bands for protein XBP1 in simvastatin pre-treated group of animals

In the group of simvastatin-treated animals, the mRNA level (Fig. 2) showed higher significant differences, more than 55 ± 3%, at ischemic phase in comparison to the control group. Significant minimum level was detected in the first hour of reperfusion (about 48 ± 5% less than control), followed by the slight non-significant increase in later reperfusion periods.

The influence of simvastatin on mRNA level was significant only in the first and the third hours of reperfusion compared to control I/R animals (about 32.8 ± 4.1% lower and two times higher in I3R, respectively).

The changes in mRNA levels were not projected onto protein levels (Fig. 3), which, in contrast to control I/R animals, we found to be significantly lower (about 37.4 ± 2.2% in ischemic phase and about 36.3 ± 5.7% lower in first hour of reperfusion). The protein level reached significant minimum in ischemic phase (21.4 ± 3.2% less than statin control), followed by a slight non-significant increase in the third and a non-significant decrease at 24th hour of reperfusion.

GRP78

In non-treated animals, the mRNA level for GRP78 (Fig. 4) showed maximal significant changes in ischemic phase (58 ± 2.5% more than control), followed by the decrease in the first period of reperfusion, and significant minimum was reached at third hour of reperfusion (about 66 ± 2.8% less than control). At 24 h of reperfusion, the mRNA level significantly increased to 43 ± 3.4% higher than control.

Fig. 4.

Fig. 4

Open in a new tab

mRNA levels of GRP78 in rat forebrain after 15 min. ischemia and 1, 3, and 24 h reperfusion, comparison between groups with and without simvastatin pre-treatment, respectively. Results are presented as mean ± SEM for n = 6, normalized to control levels. * P < 0.05; ** P < 0.01; *** P < 0.001 significantly different as compared to naïve and pre-treated controls, respectively. +++, 000 P < 0.001 mean significantly different between naïve ischemic and pre-treated animals in the same time points

Increased mRNA values also correspond with the non-significant higher levels of GRP78 protein (Fig. 5) in the ischemic phase. However, the level of GRP78 at 24 h of reperfusion significantly decreases to sub-control levels (about 22.1 ± 3.1% compared to control), likely as a consequence of reduced mRNA level at three hours of reperfusion.

Fig. 5.

Fig. 5

Open in a new tab

Protein levels of GRP78 in rat forebrain after 15 min. ischemia and 1, 3, and 24 h reperfusion (a) comparison between groups with and without simvastatin pre-treatment, respectively. Results are presented as mean ± SEM for n = 6, normalized to control levels. ** P < 0.01 significantly different as compared to naïve and pre-treated controls, respectively. ++ P < 0.01; 0, X P < 0.5 mean significantly different between naïve ischemic and pre-treated animals in the same time points. (b) Detected bands for protein GRP78 in naïve ischemic animals. (c) detected bands for protein GRP78 in simvastatin pre-treated group of animals

The mRNA level in simvastatin-treated animals (Fig. 4) showed significant maximum in ischemic phase (about 72.3 ± 2.3% more than control), the value significantly decreased at the first hour of reperfusion (about 27.6 ± 4.1% than control) followed by slight significant increase from third hour to 24 h of reperfusion (at 24 h, the mRNA level was about 35.1 ± 5.7% higher than control).

Simvastatin pre-treatment influenced the mRNA levels significantly at the first and third hour of reperfusion (about 42.4 ± 2.3% lower and 2.8 times higher in comparison to non-treated animals, respectively).

The level of GRP78 protein (Fig. 5) in simvastatin-treated group was non-significantly increased in ischemic time, and reached non-significant maximal values at third hour of reperfusion, followed by a significant decrease at 24 h to 80.1 ± 3% of control value.

Simvastatin pre-treatment caused the significant decrease of GRP78 protein levels at the first and 24 h of reperfusion (values about 34.3 ± 4.1% at I1R and 8.2 ± 1.1% at I24R lower in comparison to non-treated animals, respectively). At third hour of reperfusion we detected significant increase in GRP78 protein level (about 12.5 ± 5.3% higher value compared to I3R of non-treated animals).

ATF6

In non-treated animals, the level of mRNA for ATF6 (Fig. 6) showed non-significant increase in ischemic phase, followed by significant decrease from first hour of reperfusion to minimum attained in the third hour of reperfusion (60 ± 3% lower than control). At 24 h reperfusion was the mRNA level of ATF6 significantly increased and reached a value that was about 47 ± 6.8% higher than the control.

Fig. 6.

Fig. 6

Open in a new tab

mRNA levels of ATF6 in rat forebrain after 15 min. ischemia and 1, 3, and 24 h reperfusion, comparison between groups with and without simvastatin pre-treatment, respectively. Results are presented as mean ± SEM for n = 6, normalized to control levels. * P < 0.05; *** P < 0.001 significantly different as compared to naïve and pre-treated controls, respectively. # P < 0.05; 00  P < 0.01; XXX P < 0.001 mean significantly different between naïve ischemic and pre-treated animals in the same time points

Protein level in non-treated animals (Fig. 7) did not show remarkable changes except in the third hour of reperfusion, when the level of p90ATF6 was significantly increased (about 38.2 ± 4.5% higher than control).

Fig. 7.

Fig. 7

Open in a new tab

Protein levels of ATF6 in rat forebrain after 15 min. ischemia and 1, 3, and 24 h reperfusion (a) comparison between groups with and without simvastatin pre-treatment distinctively. Results are presented as mean ± SEM for n = 6, normalized to control levels. * P < 0.05 significantly different as compared to naïve and pre-treated controls, respectively. ++ P < 0.01; 000, ***, ### P < 0.001 mean significantly different between naïve ischemic and pre-treated animals in the same time points. B) detected bands for protein ATF6 in naïve ischemic animals. C) detected bands for protein ATF6 in simvastatin pre-treated group of animals

Simvastatin pre-treatment induced remarkable changes in both the mRNA and the protein levels. In simvastatin pre-treated animals (Fig. 6), the mRNA level at ischemic phase reached significant (more than double) levels in comparison to controls, however, in earlier reperfusion times the values decreased with a significant minimum seen in the first hour of reperfusion (less about 29.8 ± 3.6% than control). After 24 h of reperfusion significantly decreased value of mRNA (about 20.2 ± 2.6% lower than control) was also visible.

Simvastatin pre-treatment influenced the mRNA levels of ATF6 with significant increase in ischemic period and at third hour of reperfusion (about 35.2 ± 6.6% and 42 ± 2.6% higher level than non-treated animals), followed by a significant decrease at 24 h of reperfusion (about 88.2 ± 5.3% less than non-treated animals).

The p90ATF6 protein level of pre-treated animals (Fig. 7) showed similar behavior as non-treated animals. We detected a significant increase at the third hour of reperfusion (about 40.6 ± 5.2% higher than control) along with a significant decrease after 24 h of reperfusion (about 41.3 ± 3.4% lower than control).

Influence of simvastatin pre-treatment on the protein level of ATF6 was visible in significant higher values, at least about 60% higher (except I24R) compared to non-statin animals (Fig. 7). However, as in non-treated animals, the protein level of p90ATF6 decreased in I24R to levels slightly higher than control of simvastatin-treated animals.

Discussion

In this study, we were interested in finding whether global ischemia induced by four vessel occlusion followed by reperfusion at different time points would initiate the unfolded protein response of ER in cortical neurons. In addition, we have proved that prophylactic simvastatin therapy affects expression of gene coding for the main proteins involved in UPR.

Clinical trials demonstrated that 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors or statins exert beneficial effects when used as stroke prophylactic agents (Byington et al. 2001; Vaughan et al. 2001). These studies showed that statins reduce the incidence of both first and secondary events by 25–30% and prevention is believed to be achieved mainly through their activity on blood vessel wall function. However, in addition to exerting anti-atherosclerotic and anti-thrombotic effects, statins also possess anti-inflammatory and neuroprotective actions, which have been identified as cholesterol-independent or pleiotropic effects (Vaughan and Delanty 1999; Takemoto and Liao 2001). The findings indicated that administration of simvastatin or other statins reduced the size of brain damage (Sironi et al. 2003; Amin-Hanjan et al. 2001). The beneficial effect of simvastatin is achieved only when the drug is administered before the ischemic insult; therefore, acting as a prophylactic agent (Balduini et al. 2003). In the model of focal ischemia induced by middle carotid artery occlusion (MCAO), the size of the damaged tissue increased by 47% after 24 h and by 83% after 48 h as compared to the infarct size detected at 2 h. This time-dependent enhancement of the damage was abolished in animals pre-treated with simvastatin, as the volume of infarct was never larger than the volume reported 2 h after MCAO. (Cimino et al. 2005).

In general, I/R injury initiates suppression of global proteosynthesis (de la Vega et al. 2001; Paschen 2003a). Ischemia is one of the strongest stimuli of gene induction in the brain. Different gene systems related to reperfusion processes of brain injury, repair, and recovery are up-regulated (Gidday 2006). Focal ischemia shorter than 3.5 min and seven days of reperfusion usually causes degeneration of 75% of the neurons in the hippocampal CA1 region (Ohtsuki et al. 1996). On the other hand 6–10-min-long global ischemia and three days of reperfusion caused death of almost all pyramidal neurons in the same hippocampal area (Coimbra and Wieloch 1994). Until now, the literature does not mention anything about the influence of term coagulation of vertebral arteries on biochemical or behavioral changes using 4-VO. We did not detect any changes during our experiments, probably because blood deprivation in some parts of the brain was compensated through circle of Willis using higher blood pressure from carotid arteries.

The results of our experiments showed significant increase of XBP1 mRNA level in ischemic phase in comparison to control (about 43% more). These findings are similar to those observed by Paschen (2003a), which showed a marked increase in processed XBP1 mRNA levels using semi-quantitative RT-PCR after focal ischemia. These changes were most pronounced in the cerebral cortex, where high levels were found throughout the entire observation period. We obtained similar results; however, the differences were smaller probably due to the different ischemic model. The rapid increase of mRNA level of XBP1 along with other genes in ischemic phase of non-treated animals was probably due to forthcoming dissociation of protein GRP78, which reached a maximum at ischemic phase and first hour of reperfusion (Fig. 5), from bounds with sensors of UPR which quickly (ATF6) or slowly (XBP1) started transcription of effector’s genes. In simvastatin-treated animals, rapid increase of mRNA in ischemic phase was mainly a consequence of transcription factor ATF6.

It has been proposed that the strong inhibition of translation induced after transient cerebral ischemia prevents the expression of key effector UPR proteins such as the XBP1, GRP78, or ATF4, thereby hindering recovery from ischemia-induced ER dysfunction (Kumar et al. 2001; Paschen 2003a) and possibly leading to a pro-apoptotic phenotype (DeGracia and Montie 2004). According to the authors, no increase in processed XBP1 protein levels was found during the first 3 h of reperfusion even when processing of XBP1 mRNA was already maximally activated. Similarly, in our experiments, we did not detect any significant changes in the protein level of XBP1 neither in ischemic period nor in the first 24 h of reperfusion.

The results from measurements of XBP1 mRNA in simvastatin-treated animals did not show any significant changes in comparison to naive ischemic animals, i.e., the maximal differences were detected in the first and third hour of reperfusion (about 32.8 ± 4.1% lower in I1R and two times higher in I3R, respectively). A bit surprisingly, the protein level of XBP1 was generally decreased in pre-treated animals (mainly in ischemic and I1R phase than non treated group), and did not reach control levels. Recently, a novel action of statins was proven in neurons, involving cell growth and signaling as well as down-regulation of proinflammatory gene expression attenuating neurogenic inflammation (Johnson-Anuna et al. 2005; Bucelli et al. 2008). Till now, no information was available on the possible influence of statins on mRNA stability or translational machinery of ER resident genes.

The results of real-time PCR measurement showed an increased mRNA level of GRP78 in ischemic time and at later phases of reperfusion in non-treated animals. Probable reason is that GRP78 is a member of the 70-kDa heat shock protein family that acts as a molecular chaperone in the folding and assembly of newly synthesized proteins within the ER. Recently, Yu et al. (1999) reported that suppression of GRP78 expression enhanced apoptosis and disruption of cellular calcium homeostasis in hippocampal neurons exposed to excitotoxic and oxidative insults. This indicates that a raised level of GRP78 makes cells more resistant to the stressful conditions (Aoki et al. 2001). Contrary to this, Paschen (2003a), using models of both focal and global ischemia, failed to find any significant increase in GRP78 or GRP94 mRNA levels after 5–6 h of reperfusion. Morimoto et al. (2007) using focal ichemia model, detected the maximum level of GRP78 mRNA after 6 h of reperfusion, which also support our results. In our experiments, we did not find any significant changes in protein levels of GRP78 neither in simvastatin-treated nor in non-treated group of animals. We have just found maximum at third hour of reperfusion in statin group and small decrease at 24 h of reperfusion in both groups. Our results are similar to the findings of Burda et al. (2003), who failed to find any differences in GRP78 protein levels at any of the reperfusion times considered (max 4 h), either in rats with or without acquired ischemic tolerance. However, in a model of ischemic preconditioning in rats (Hayashi et al. 2003; García et al. 2004) an increase in GRP78 expression was detected after 2 days of preconditioning. Authors proposed that development of tolerance includes changes in PERK/GRP78 association, which were responsible for the decrease in eIF2a phosphorylation induced by preconditioning. Other studies using distinct ischemic models also failed to detect increased levels of GRP78 protein (Paschen 2003a).

In simvastatin-treated animals mRNA levels were found to be similar in comparison to naïve ischemic animals. However, protein was expressed in lower levels of GRP78 with the exception of 3 h reperfusion time.

In a screen for compounds that induce the ER-mediated chaperone GRP78 (78 kDa glucose-regulated protein, BiP), BiP inducer X (BIX) was recently identified. BIX preferentially induced GRP78 with slight inductions of GRP94, calreticulin, and C/EBP homologous protein. The induction of BiP mRNA by BIX is mediated by activation of ER stress response elements upstream to the BiP gene, through the ATF6 pathway (Kudo et al. 2008). The results of our experiments showed increased mRNA expression form ATF6 only in ischemic time, consequently levels of mRNA for GRP78 were increased only slightly compared to controls. This is in accordance with the above-mentioned results. The IRE1 pathway, mediates transcriptional induction of not only ER quality control proteins (molecular chaperones, folding enzymes, and components of ER-associated degradation) but also proteins working at various stages of secretion. The PERK pathway is responsible for translational control and also participates in transcriptional control in mammals. ATF6 is an ER-membrane-bound transcription factor activated by ER stress that is specialized in the regulation of ER quality control proteins (Adachi et al. 2008). The minimum level of mRNA for ATF6 was observed at third hour of reperfusion followed by increase till 24 h of reperfusion. This minimum was probably due to pro-survival mechanism through inhibition of pro-apoptotic protein GADD153, which usually acts as a transcription factor of UPR genes. GADD153 protein decreased during reperfusion, until the minimum was reached at the third hour of reperfusion (Kumar et al. 2003). Level of protein reached the maximum at third hour of reperfusion, what correlates with results of Haze et al. (1999). They also found that the over expression of full-length ATF6 slightly activated transcription of the GRP78 gene. We also showed significant higher levels of ATF6 mRNA in statin-treated animals in comparison to non-statin animals at ischemic period and at third hour of reperfusion (about 35.2 ± 6.6% and 42 ± 2.6% higher level), which was also translated into the higher protein level, whose values had significant maximum at third hour of reperfusion (about 60% higher level than in non-treated animals). Explanation of generally higher levels of protein p90ATF6 in simvastatin-treated group is probably connected with increased activity of NOS due to prolonged simvastatin pre-treatment (Gertz et al. 2003). In treated group the production of NO was higher, which directly started stronger UPR reaction than in non-treated group, mainly through NO depleted ER Ca2+, which increased promotor activity of GADD153 to UPR genes (Oyadomari and Mori 2004). They also reported that this NO-mediated change in Ca2+ flux activates S1P, and activates ATF6 by proteolysis in association with the S2P, resulting in the active form of soluble transcription factor ATF6.

Our results indicate that global ischemia/reperfusion initiates time-dependent differences in endoplasmic reticular gene expression at both the mRNA and protein levels. We also found generally enhanced level of mRNA in simvastatin pre-treated animals. The maximal differences between naïve ischemic and pre-treated ischemic animals were detected in protein levels of proteins ATF6 and XBP1. The level of ATF6 was 60% higher in simvastatin pre-treated animals, which might suggest that ATF6 is one of the main proteins targeted to enhance neuroprotective effect at the ER gene level during first two hours of reperfusion.

In conclusion, these data indicate that statins, in addition to their cholesterol-lowering effect may exert a neuroprotective role in the attenuation of ER stress response after acute ischemic/reperfusion insult. Changes in gene expression of the key proteins provide an insight into ER stress pathways and might suggest possible targets of future therapeutic interventions to enhance recovery after stroke.

Acknowledgments

This work was supported by grants VEGA 3380/06 and 0027/08, MVTS-COST B30, VVCE0064-07-06, from the Ministry of Education and Science of the Slovak Republic and European Social Fund SORO 328/2005. P.U. is grateful to prof. L. Kaczmarek, Nencki Institute, Warsaw, Poland, for his hospitality.

References

  1. Adachi Y, Yamamoto K, Okada T, Yoshida H, Harada A, Mori K (2008) ATF6 is a transcription factor specializing in the regulation of quality control proteins in the endoplasmic reticulum. Cell Struct Funct 33:75–89. doi:10.1247/csf.07044 [DOI] [PubMed] [Google Scholar]
  2. Amin-Hanjan S, Stagliano NE, Yamada M, Huang PL, Liao JK, Moskowitz MA (2001) Mevastatin, an HMG-CoA reductase inhibitor, reduces stroke damage and upregulates endothelial nitric oxide synthase in mice. Stroke 32:980–986 [DOI] [PubMed] [Google Scholar]
  3. Aoki M, Tamatani M, Taniguchi M, Yamaguchi A, Bando Y, Kasai K et al (2001) Hypothermic treatment restores glucose regulated protein 78 (GRP78) expression in ischemic brain. Brain Res Mol Brain Res 95(1–2):117–128. doi:10.1016/S0169-328X(01)00255-8 [DOI] [PubMed] [Google Scholar]
  4. Balduini W, Mazzoni E, Carloni S, De Simoni MG, Perego C, Sironi L (2003) Prophylactic but not delayed administration of simvastatin protects against long-lasting cognitive and morphological consequences of neonatal hypoxic-ischemic brain injury, reduces interleukin-1beta and tumor necrosis factoralpha mRNA induction, and does not affect endothelial nitric oxide synthase expression. Stroke 34:2007–2012. doi:10.1161/01.STR.0000080677.24419.88 [DOI] [PubMed] [Google Scholar]
  5. Bucelli RC, Gonsiorek EA, Kim WY, Bruun D, Rabin RA, Higgins D et al (2008) Statins decrease expression of the proinflammatory neuropeptides calcitonin gene-related peptide and substance P in sensory neurons. J Pharmacol Exp Ther 324(3):1172–1180. doi:10.1124/jpet.107.132795 [DOI] [PubMed] [Google Scholar]
  6. Burda J, Hrehorovska M, García BL, Danielisova V, Cízkova D, Burda R et al (2003) Role of protein synthesis in the ischemic tolerance acquisition induced by transient forebrain ischemia in the rat. Neurochem Res 28:1237–1243. doi:10.1023/A:1024232513106 [DOI] [PubMed] [Google Scholar]
  7. Byington RP, Davis BR, Plehn JF, White HD, Baker J, Cobbe SM (2001) Reduction of stroke events with pravastatin: the Prospective Pravastatin Pooling (PPP) Project. Circulation 103:387–392 [DOI] [PubMed] [Google Scholar]
  8. Calfon M, Zeng H, Urano F, Till JH, Hubbart SR, Harding HP et al (2002) IRE1 couples endoplasmic reticulum load to secretory capacity by processing XBP-1 mRNA. Nature 415:92–96. doi:10.1038/415092a [DOI] [PubMed] [Google Scholar]
  9. Cimino M, Balduini W, Carloni S, Gelosa P, Guerrini U, Tremoli E et al (2005) Neuroprotective effect of simvastatin in stroke: a comparison between adult and neonatal rat models of cerebral ischemia. Neurotoxicology 26:929–933. doi:10.1016/j.neuro.2005.03.009 [DOI] [PubMed] [Google Scholar]
  10. Coimbra C, Wieloch T (1994) Moderate hypothermia mitigates neuronal damage in the rat brain when initiated several hours following transient cerebral ischemia. Acta Neuropathol 87:325–331. doi:10.1007/BF00313599 [DOI] [PubMed] [Google Scholar]
  11. DeGracia DJ, Montie HL (2004) Cerebral ischemia and the unfolded protein response. J Neurochem 91(1):1–8. doi:10.1111/j.1471-4159.2004.02703.x [DOI] [PubMed] [Google Scholar]
  12. DeGracia DJ, Kumar R, Owen CR, Krause GS, White BC (2002) Molecular pathways of protein synthesis inhibition during brain reperfusion: implications for neuronal survival or death. J Cereb Blood Flow Metab 22:127–141. doi:10.1097/00004647-200202000-00001 [DOI] [PubMed] [Google Scholar]
  13. De la Vega MC, Burda J, Nemethova M, Quevedo C, Alcazar A, Martin ME et al (2001) Possible mechanisms involved in the down-regulation of translation during transient global ischaemia in the rat brain. Biochem J 357:819–826. doi:10.1042/0264-6021:3570819 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. García L, Burda J, Hrehorovska M, Burda R, Martin E, Salinas M (2004) Ischaemic preconditioning in the rat brain: effect on the activity of several initiation factors, Akt and extracellular signal-regulated protein kinase phosphorylation, and GRP78and GADD34 expression. J Neurochem 88:136–147 [DOI] [PubMed] [Google Scholar]
  15. Gertz K, Laufs U, Lindauer U, Nickenig G, Bohm M, Dirnagl U et al (2003) Withdrawal of statin treatment abrogates stroke protection in mice. Stroke 34:551–557. doi:10.1161/01.STR.0000054055.28435.BF [DOI] [PubMed] [Google Scholar]
  16. Gidday JM (2006) Cerebral preconditioning and ischaemic tolerance. Nat Rev Neurosci 7(6):437–448. doi:10.1038/nrn1927 [DOI] [PubMed] [Google Scholar]
  17. Harding HP, Zhang Y, Ron D (1999) Protein translation and folding are coupled by an endoplasmic reticulum-resident kinase. Nature 397:271–274. doi:10.1038/16729 [DOI] [PubMed] [Google Scholar]
  18. Hayashi T, Saito A, Okuno S, Ferrand-Drake M, Dodd RL, Nishi T et al (2003) Oxidative damage to the endoplasmic reticulum is implicated in ischemic neuronal cell death. J Cereb Blood Flow Metab 23:1117–1128. doi:10.1097/01.WCB.0000089600.87125.AD [DOI] [PubMed] [Google Scholar]
  19. Hayashi T, Hamakawa K, Nagotani S, Jin G, Li F, Deguchi K et al (2005) HMG CoA reductase inhibitors reduce ischemic brain injury of Wistar rats through decreasing oxidative stress on neurons. Brain Res 1037(1–2):52–58. doi:10.1016/j.brainres.2004.12.051 [DOI] [PubMed] [Google Scholar]
  20. Haze K, Yoshida H, Yanagi H, Yura T, Mori K (1999) Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress. Mol Biol Cell 10:3787–3799 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Imaizumi K, Katayama T, Tohyama M (2001) Presenilin and the UPR. Nat Cell Biol 3:E104. doi:10.1038/35074613 [DOI] [PubMed] [Google Scholar]
  22. Johnson-Anuna LN, Eckert GP, Keller JH, Igbavboa U, Franke C, Fechner T et al (2005) Chronic administration of statins alters multiple gene expression patterns in mouse cerebral cortex. J Pharmacol Exp Ther 312(2):786–793. doi:10.1124/jpet.104.075028 [DOI] [PubMed] [Google Scholar]
  23. Kudo T, Kanemoto S, Hara H, Morimoto N, Morihara T, Kimura R et al (2008) A molecular chaperone inducer protects neurons from ER stress. Cell Death Differ 15(2):364–375. doi:10.1038/sj.cdd.4402276 [DOI] [PubMed] [Google Scholar]
  24. Kumar R, Azam S, Sullivan JM, Owen C, Cavener DR, Zhang P et al (2001) Brain ischemia and reperfusion activate the eukaryotic initiation factor 2a kinase, PERK. J Neurochem 77:1418–1421. doi:10.1046/j.1471-4159.2001.00387.x [DOI] [PubMed] [Google Scholar]
  25. Kumar R, Krause GS, Yoshida H, Mori K, DeGracia DJ (2003) Dysfunction of the unfolded protein response during global brain ischemia and reperfusion. J Cereb Blood Flow Metab 23:462–471. doi:10.1097/00004647-200304000-00010 [DOI] [PubMed] [Google Scholar]
  26. Lehotský J, Murín R, Strapková A, Uríková A, Tatarková Z, Kaplán P (2004) Time course of ischemia/reperfusion-induced oxidative modification of neural proteins in rat forebrain. Gen Physiol Biophys 23(4):401–415 [PubMed] [Google Scholar]
  27. Morimoto N, Oida Y, Shimazawa M, Miura M, Kudo T, Imaizumi K et al (2007) Involvement of endoplasmic reticulum stress after middle cerebral artery occlusion in mice. Neuroscience 147(4):957–967. doi:10.1016/j.neuroscience.2007.04.017 [DOI] [PubMed] [Google Scholar]
  28. Nagotani S, Hayashi T, Sato K, Zhang W, Deguchi K, Nagano I et al (2005) Reduction of cerebral infarction in stroke-prone spontaneously hypertensive rats by statins associated with amelioration of oxidative stress. Stroke 36(3):670–672. doi:10.1161/01.STR.0000155732.27333.3c [DOI] [PubMed] [Google Scholar]
  29. Ohtsuki T, Reutzler CA, Tasaki K, Hallenbeck JM (1996) Interleukin-1 mediates induction of tolerance to global ischemia in gerbil hippocampal CA1 neurons. J Cereb Blood Flow Metab 16:1137–1142. doi:10.1097/00004647-199611000-00007 [DOI] [PubMed] [Google Scholar]
  30. Oyadomari S, Mori M (2004) Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ 381:381–389. doi:10.1038/sj.cdd.4401373 [DOI] [PubMed] [Google Scholar]
  31. Paschen W (2003a) Endoplasmic reticulum: a primary target in various acute disorders and degenerative diseases of the brain. Cell Calcium 34:365–383. doi:10.1016/S0143-4160(03)00139-8 [DOI] [PubMed] [Google Scholar]
  32. Paschen W (2003b) Shutdown of translation: lethal or protective? Unfolded protein response versus apoptosis. J Cereb Blood Flow Metab 23:773–779. doi:10.1097/01.WCB.0000075009.47474.F9 [DOI] [PubMed] [Google Scholar]
  33. Pulsinelli WA, Brierley JB, Plum F (1982) Temporal profile of neuronal damage in a model of transient forebrain ischemia. Ann Neurol 11(5):491–498. doi:10.1002/ana.410110509 [DOI] [PubMed] [Google Scholar]
  34. Qi X, Okuma Y, Hosoi T, Nomura Y (2004) Edaravone protects against hypoxia/ischemia-induced endoplasmic reticulum dysfunction. J Pharmacol Exp Ther 311:388–393. doi:10.1124/jpet.104.069088 [DOI] [PubMed] [Google Scholar]
  35. Shabanzadeh AP, Shuaib A, Wang CX (2005) Simvastatin reduced ischemic brain injury and perfusion deficits in an embolic model of stroke. Brain Res 1042(1):1–5. doi:10.1016/j.brainres.2005.01.105 [DOI] [PubMed] [Google Scholar]
  36. Shen X, Ellis RE, Lee K, Liu CY, Yang K, Solomon A et al (2001) Complementary signaling pathways regulate the unfolded protein response and are required for C. elegans development. Cell 107:893–903. doi:10.1016/S0092-8674(01)00612-2 [DOI] [PubMed] [Google Scholar]
  37. Sironi L, Cimino M, Guerrini U, Calvio AM, Lodetti B, Asdente M (2003) Treatment with statins after induction of focal ischemia in rats reduces the extent of brain damage. Arterioscler Thromb Vasc Biol 23:322–327. doi:10.1161/01.ATV.0000044458.23905.3B [DOI] [PubMed] [Google Scholar]
  38. Sivonová M, Kaplán P, Duracková Z, Dobrota D, Drgová A, Tatarková Z et al (2008) Time course of peripheral oxidative stress as consequence of global ischaemic brain injury in rats. Cell Mol Neurobiol 28(3):431–441. doi:10.1007/s10571-007-9246-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Takemoto M, Liao JK (2001) Pleiotropic effects of 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitors. Arterioscler Thromb Vasc Biol 21:1712–1719. doi:10.1161/hq1101.098486 [DOI] [PubMed] [Google Scholar]
  40. Uríková A, Babusíková E, Dobrota D, Drgová A, Kaplán P, Tatarková Z et al (2006) Impact of Ginkgo Biloba Extract EGb 761 on ischemia/reperfusion–induced oxidative stress products formation in rat forebrain. Cell Mol Neurobiol 26:1343–1353. doi:10.1007/s10571-006-9030-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Vaughan CJ, Delanty N (1999) Neuroprotective properties of statins in cerebral ischemia and stroke. Stroke 30:1969–1973 [DOI] [PubMed] [Google Scholar]
  42. Vaughan CJ, Delanty N, Basson CT (2001) Statin therapy and stroke prevention. Curr Opin Cardiol 16:219–224. doi:10.1097/00001573-200107000-00001 [DOI] [PubMed] [Google Scholar]
  43. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K (2001) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107:881–891. doi:10.1016/S0092-8674(01)00611-0 [DOI] [PubMed] [Google Scholar]
  44. Yoshida H, Matsui T, Hosokawa N, Kaufman RJ, Nagata K, Mori K (2003) A time-dependent phase shift in the mammalian unfolded protein response. Dev Cell 4:265–271. doi:10.1016/S1534-5807(03)00022-4 [DOI] [PubMed] [Google Scholar]
  45. Yu ZW, Lou H, Fu W, Mattson MP (1999) The endoplasmic reticulum stress-responsive protein GRP78 protects neurons against excitotoxicity and apoptosis: Suppression of oxidative stress and stabilization of calcium homeostasis. Exp Neurol 155:302–314. doi:10.1006/exnr.1998.7002 [DOI] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Neurobiology are provided here courtesy of Springer

RESOURCES